EMAIL THIS PAGE TO A FRIEND

FAM99A

family with sequence similarity 99, member A (non-protein coding)

22 Gene Product Result for
Species: Human FAM99A(387742)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014374 Rosetta Predictions human pricing
XR_040838 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198209 predicted 1101
2 SASI_Hs01_00198210 predicted 1087
3 SASI_Hs01_00198211 predicted 1084
4 SASI_Hs01_00198212 predicted 1072
5 SASI_Hs01_00198213 predicted 602
6 SASI_Hs01_00198214 predicted 1978
7 SASI_Hs01_00198215 predicted 1753
8 SASI_Hs01_00198216 predicted 1976
9 SASI_Hs01_00198217 predicted 1513
10 SASI_Hs01_00198218 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522387 predicted 141
2 SASI_Hs02_00522388 predicted 159
3 SASI_Hs02_00522389 predicted 152
4 SASI_Hs02_00522390 predicted 141
5 SASI_Hs02_00522391 predicted 87
6 SASI_Hs02_00522392 predicted 89
7 SASI_Hs02_00522393 predicted 135
8 SASI_Hs02_00522394 predicted 130
9 SASI_Hs02_00522395 predicted 89
10 SASI_Hs02_00522396 predicted 62
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014374
FAM99A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 99, member A (non-protein coding)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-991s1c1
Sequence:CCGGCCCACGACATCAGGTAAACATCTCGAGATGTTTACCTGATGTCGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1309s1c1
Sequence:CCGGCGAGAAGAATCTGCTGGGATACTCGAGTATCCCAGCAGATTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1091s1c1
Sequence:CCGGCCGCCGAGACATTTCGTAATTCTCGAGAATTACGAAATGTCTCGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1125s1c1
Sequence:CCGGCCTTGCATTCCTTCCCTAAATCTCGAGATTTAGGGAAGGAATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1370s1c1
Sequence:CCGGGCTTCCTTTGAGAGCAGATTACTCGAGTAATCTGCTCTCAAAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1310s1c1
Sequence:CCGGGAGAAGAATCTGCTGGGATAACTCGAGTTATCCCAGCAGATTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-959s1c1
Sequence:CCGGCAGTCTGATTTCCAATGTAAACTCGAGTTTACATTGGAAATCAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-954s1c1
Sequence:CCGGGTAAACAGTCTGATTTCCAATCTCGAGATTGGAAATCAGACTGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-965s1c1
Sequence:CCGGGATTTCCAATGTAAACCAGATCTCGAGATCTGGTTTACATTGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014374.1-601s1c1
Sequence:CCGGCTCTGCTTCCAGAACACACTACTCGAGTAGTGTGTTCTGGAAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014374
FAM99A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 99, member A (non-protein coding)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-991s1c1
Sequence:CCGGCCCACGACATCAGGTAAACATCTCGAGATGTTTACCTGATGTCGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1309s1c1
Sequence:CCGGCGAGAAGAATCTGCTGGGATACTCGAGTATCCCAGCAGATTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1091s1c1
Sequence:CCGGCCGCCGAGACATTTCGTAATTCTCGAGAATTACGAAATGTCTCGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1125s1c1
Sequence:CCGGCCTTGCATTCCTTCCCTAAATCTCGAGATTTAGGGAAGGAATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1370s1c1
Sequence:CCGGGCTTCCTTTGAGAGCAGATTACTCGAGTAATCTGCTCTCAAAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1310s1c1
Sequence:CCGGGAGAAGAATCTGCTGGGATAACTCGAGTTATCCCAGCAGATTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-959s1c1
Sequence:CCGGCAGTCTGATTTCCAATGTAAACTCGAGTTTACATTGGAAATCAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-954s1c1
Sequence:CCGGGTAAACAGTCTGATTTCCAATCTCGAGATTGGAAATCAGACTGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-965s1c1
Sequence:CCGGGATTTCCAATGTAAACCAGATCTCGAGATCTGGTTTACATTGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014374.1-601s1c1
Sequence:CCGGCTCTGCTTCCAGAACACACTACTCGAGTAGTGTGTTCTGGAAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014374
FAM99A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 99, member A (non-protein coding)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-991s1c1
Sequence:CCGGCCCACGACATCAGGTAAACATCTCGAGATGTTTACCTGATGTCGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1309s1c1
Sequence:CCGGCGAGAAGAATCTGCTGGGATACTCGAGTATCCCAGCAGATTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1091s1c1
Sequence:CCGGCCGCCGAGACATTTCGTAATTCTCGAGAATTACGAAATGTCTCGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1125s1c1
Sequence:CCGGCCTTGCATTCCTTCCCTAAATCTCGAGATTTAGGGAAGGAATGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1370s1c1
Sequence:CCGGGCTTCCTTTGAGAGCAGATTACTCGAGTAATCTGCTCTCAAAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-1310s1c1
Sequence:CCGGGAGAAGAATCTGCTGGGATAACTCGAGTTATCCCAGCAGATTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-959s1c1
Sequence:CCGGCAGTCTGATTTCCAATGTAAACTCGAGTTTACATTGGAAATCAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-954s1c1
Sequence:CCGGGTAAACAGTCTGATTTCCAATCTCGAGATTGGAAATCAGACTGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014374.1-965s1c1
Sequence:CCGGGATTTCCAATGTAAACCAGATCTCGAGATCTGGTTTACATTGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014374.1-601s1c1
Sequence:CCGGCTCTGCTTCCAGAACACACTACTCGAGTAGTGTGTTCTGGAAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)