EMAIL THIS PAGE TO A FRIEND

Fasl

14 Gene Product Result for
Species: Mouse Fasl(14103)
Gene ID:
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F2928 Monoclonal Anti-Fas Ligand antibody produced in rat clone 101624, purified immunoglobulin, lyophilized powder mouse
neutralization, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0785 Mouse Fas L ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026881 MISSION® esiRNA esiRNA targeting mouse Fasl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_010177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153900 predicted 240
2 SASI_Mm01_00153901 predicted 1131
3 SASI_Mm01_00153902 predicted 826
4 SASI_Mm01_00153903 predicted 1165
5 SASI_Mm01_00153904 predicted 1321
6 SASI_Mm01_00153905 predicted 964
7 SASI_Mm01_00153906 predicted 1096
8 SASI_Mm01_00153907 predicted 884
9 SASI_Mm01_00153908 predicted 982
10 SASI_Mm01_00153909 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010177
Fasl MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010177.2-1604s1c1
Sequence:CCGGGCACAAATCATTCTCTACATACTCGAGTATGTAGAGAATGATTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-771s1c1
Sequence:CCGGCTTCGTGTATTCCAAAGTATACTCGAGTATACTTTGGAATACACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-481s1c1
Sequence:CCGGGCTCTGGTTGGAATGGGATTACTCGAGTAATCCCATTCCAACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-557s1c1
Sequence:CCGGCCAACCAAAGCCTTAAAGTATCTCGAGATACTTTAAGGCTTTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-828s1c1
Sequence:CCGGCCACAAGGTCTATATGAGGAACTCGAGTTCCTCATATAGACCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010177
Fasl MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010177.2-1604s1c1
Sequence:CCGGGCACAAATCATTCTCTACATACTCGAGTATGTAGAGAATGATTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-771s1c1
Sequence:CCGGCTTCGTGTATTCCAAAGTATACTCGAGTATACTTTGGAATACACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-481s1c1
Sequence:CCGGGCTCTGGTTGGAATGGGATTACTCGAGTAATCCCATTCCAACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-557s1c1
Sequence:CCGGCCAACCAAAGCCTTAAAGTATCTCGAGATACTTTAAGGCTTTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-828s1c1
Sequence:CCGGCCACAAGGTCTATATGAGGAACTCGAGTTCCTCATATAGACCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010177
Fasl MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010177.2-1604s1c1
Sequence:CCGGGCACAAATCATTCTCTACATACTCGAGTATGTAGAGAATGATTTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-771s1c1
Sequence:CCGGCTTCGTGTATTCCAAAGTATACTCGAGTATACTTTGGAATACACGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-481s1c1
Sequence:CCGGGCTCTGGTTGGAATGGGATTACTCGAGTAATCCCATTCCAACCAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-557s1c1
Sequence:CCGGCCAACCAAAGCCTTAAAGTATCTCGAGATACTTTAAGGCTTTGGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010177.2-828s1c1
Sequence:CCGGCCACAAGGTCTATATGAGGAACTCGAGTTCCTCATATAGACCTTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???