EMAIL THIS PAGE TO A FRIEND

FASTK

Fas-activated serine/threonine kinase

181 Gene Product Result for
Synonyms: FAST
UniProtKB ID: Q14296, A8K867, F8VTW9, Q59EM8, Q8IVA0
Gene ID:
Human(10922) Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(66587) Fas-activated serine/threonine kinase
Rat(296741) Fas-activated serine/threonine kinase
Zebrafish(564534) Fas-activated serine/threonine kinase
cow(509781) Fas-activated serine/threonine kinase
Horse(100063473) Fas-activated serine/threonine kinase
domestic cat(101082140) Fas-activated serine/threonine kinase
dog(482802) Fas-activated serine/threonine kinase
chicken(426636) Fas-activated serine/threonine kinase
sheep(101103314) Fas-activated serine/threonine kinase
Domestic Rabbit(100343065) Fas-activated serine/threonine kinase
naked mole-rat(101707658) Fas-activated serine/threonine kinase
domestic guinea pig(100713369) Fas-activated serine/threonine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006712 Rosetta Predictions human pricing
NM_033015 Rosetta Predictions human pricing
NM_001011967 Rosetta Predictions rat pricing
XM_575326 Rosetta Predictions rat pricing
NM_023229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107610 predicted 1143
2 SASI_Hs01_00107611 predicted 873
3 SASI_Hs02_00342136 predicted 941
4 SASI_Hs01_00107612 predicted 1387
5 SASI_Hs02_00342137 predicted 1078
6 SASI_Hs01_00107613 predicted 1077
7 SASI_Hs01_00107614 predicted 1404
8 SASI_Hs01_00107615 predicted 910
9 SASI_Hs01_00107617 predicted 1030
10 SASI_Hs01_00107618 predicted 877
11 SASI_Hs01_00107616 predicted 1286
12 SASI_Hs01_00107619 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072170 predicted 724
2 SASI_Hs01_00072171 predicted 458
3 SASI_Hs02_00360687 predicted 515
4 SASI_Hs01_00072172 predicted 964
5 SASI_Hs02_00360688 predicted 659
6 SASI_Hs01_00072173 predicted 658
7 SASI_Hs01_00072174 predicted 977
8 SASI_Hs01_00072175 predicted 484
9 SASI_Hs01_00072177 predicted 603
10 SASI_Hs01_00072178 predicted 457
11 SASI_Hs01_00072176 predicted 860
12 SASI_Hs01_00072179 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199986 predicted 343
2 SASI_Rn01_00095652 predicted 877
3 SASI_Rn01_00095653 predicted 1369
4 SASI_Rn01_00095654 predicted 942
5 SASI_Rn01_00095655 predicted 569
6 SASI_Rn01_00095656 predicted 801
7 SASI_Rn01_00095657 predicted 1154
8 SASI_Rn01_00095658 predicted 682
9 SASI_Rn01_00095659 predicted 559
10 SASI_Rn01_00095661 predicted 783
11 SASI_Rn01_00095660 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140627 predicted 878
2 SASI_Rn01_00140628 predicted 816
3 SASI_Rn01_00140629 predicted 961
4 SASI_Rn01_00140630 predicted 499
5 SASI_Rn01_00140631 predicted 730
6 SASI_Rn01_00140632 predicted 1095
7 SASI_Rn01_00140633 predicted 619
8 SASI_Rn01_00140634 predicted 453
9 SASI_Rn01_00140635 predicted 491
10 SASI_Rn01_00140636 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058980 predicted 920
2 SASI_Mm01_00058981 predicted 665
3 SASI_Mm02_00326980 predicted 854
4 SASI_Mm01_00058983 predicted 913
5 SASI_Mm01_00058984 predicted 1355
6 SASI_Mm01_00058985 predicted 1135
7 SASI_Mm01_00058986 predicted 714
8 SASI_Mm01_00058988 predicted 1141
9 SASI_Mm02_00326981 predicted 544
10 SASI_Mm01_00058989 predicted 1337
11 SASI_Mm01_00058982 predicted 332
12 SASI_Mm01_00058987 predicted 1494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006712
VALIDATED
FASTK MISSION shRNA Bacterial Glycerol Stock
Fas-activated serine/threonine kinase
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-882s1c1
Sequence:CCGGGCCCACTTCCTGGTGGTTCAGCTCGAGCTGAACCACCAGGAAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-554s1c1
Sequence:CCGGCTTTGACATTCACACCATCCACTCGAGTGGATGGTGTGAATGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1149s1c1
Sequence:CCGGGCTCTGATTGTGCGTCGCTACCTCGAGGTAGCGACGCACAATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-587s1c1
Sequence:CCGGCCTTGCAGTCTTACTTGGCTTCTCGAGAAGCCAAGTAAGACTGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-978s1c1
Sequence:CCGGCAGCAGTTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAACTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-186s1c1
Sequence:CCGGCCATCACCCAACTCCATGCTTCTCGAGAAGCATGGAGTTGGGTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-1283s1c1
Sequence:CCGGCCGCTGCAAGTACAGTCACAACTCGAGTTGTGACTGTACTTGCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-524s1c1
Sequence:CCGGGAGTCAGCTCATCATCCGAAACTCGAGTTTCGGATGATGAGCTGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1538s21c1
Sequence:CCGGGTTGCGGGAACGCTGGCATTTCTCGAGAAATGCCAGCGTTCCCGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1112s1c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-710s1c1
Sequence:CCGGAGGGTTGGAAGCTGCTCTAAGCTCGAGCTTAGAGCAGCTTCCAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1294s21c1
Sequence:CCGGACAGTCACAAGGACATAGTAGCTCGAGCTACTATGTCCTTGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1112s21c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-580s21c1
Sequence:CCGGGTCTGCACCTTGCAGTCTTACCTCGAGGTAAGACTGCAAGGTGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-525s21c1
Sequence:CCGGAGTCAGCTCATCATCCGAAACCTCGAGGTTTCGGATGATGAGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1037s21c1
Sequence:CCGGGGCTACAGTCAACATCTTGATCTCGAGATCAAGATGTTGACTGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-893s21c1
Sequence:CCGGGGTGGTTCAGGAAACGCAACTCTCGAGAGTTGCGTTTCCTGAACCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-749s21c1
Sequence:CCGGGTATCCACGGCAGCATCTGATCTCGAGATCAGATGCTGCCGTGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006712
VALIDATED
FASTK MISSION shRNA shRNA Plasmid DNA
Fas-activated serine/threonine kinase
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-882s1c1
Sequence:CCGGGCCCACTTCCTGGTGGTTCAGCTCGAGCTGAACCACCAGGAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-554s1c1
Sequence:CCGGCTTTGACATTCACACCATCCACTCGAGTGGATGGTGTGAATGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1149s1c1
Sequence:CCGGGCTCTGATTGTGCGTCGCTACCTCGAGGTAGCGACGCACAATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-587s1c1
Sequence:CCGGCCTTGCAGTCTTACTTGGCTTCTCGAGAAGCCAAGTAAGACTGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-978s1c1
Sequence:CCGGCAGCAGTTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAACTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-186s1c1
Sequence:CCGGCCATCACCCAACTCCATGCTTCTCGAGAAGCATGGAGTTGGGTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-1283s1c1
Sequence:CCGGCCGCTGCAAGTACAGTCACAACTCGAGTTGTGACTGTACTTGCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-524s1c1
Sequence:CCGGGAGTCAGCTCATCATCCGAAACTCGAGTTTCGGATGATGAGCTGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1538s21c1
Sequence:CCGGGTTGCGGGAACGCTGGCATTTCTCGAGAAATGCCAGCGTTCCCGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1112s1c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-710s1c1
Sequence:CCGGAGGGTTGGAAGCTGCTCTAAGCTCGAGCTTAGAGCAGCTTCCAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1294s21c1
Sequence:CCGGACAGTCACAAGGACATAGTAGCTCGAGCTACTATGTCCTTGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1112s21c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-580s21c1
Sequence:CCGGGTCTGCACCTTGCAGTCTTACCTCGAGGTAAGACTGCAAGGTGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-525s21c1
Sequence:CCGGAGTCAGCTCATCATCCGAAACCTCGAGGTTTCGGATGATGAGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1037s21c1
Sequence:CCGGGGCTACAGTCAACATCTTGATCTCGAGATCAAGATGTTGACTGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-893s21c1
Sequence:CCGGGGTGGTTCAGGAAACGCAACTCTCGAGAGTTGCGTTTCCTGAACCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-749s21c1
Sequence:CCGGGTATCCACGGCAGCATCTGATCTCGAGATCAGATGCTGCCGTGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006712
VALIDATED
FASTK MISSION shRNA Lentiviral Transduction Particles
Fas-activated serine/threonine kinase
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-882s1c1
Sequence:CCGGGCCCACTTCCTGGTGGTTCAGCTCGAGCTGAACCACCAGGAAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-554s1c1
Sequence:CCGGCTTTGACATTCACACCATCCACTCGAGTGGATGGTGTGAATGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1149s1c1
Sequence:CCGGGCTCTGATTGTGCGTCGCTACCTCGAGGTAGCGACGCACAATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-587s1c1
Sequence:CCGGCCTTGCAGTCTTACTTGGCTTCTCGAGAAGCCAAGTAAGACTGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-978s1c1
Sequence:CCGGCAGCAGTTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAACTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-186s1c1
Sequence:CCGGCCATCACCCAACTCCATGCTTCTCGAGAAGCATGGAGTTGGGTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006712.3-1283s1c1
Sequence:CCGGCCGCTGCAAGTACAGTCACAACTCGAGTTGTGACTGTACTTGCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006712.3-524s1c1
Sequence:CCGGGAGTCAGCTCATCATCCGAAACTCGAGTTTCGGATGATGAGCTGACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1538s21c1
Sequence:CCGGGTTGCGGGAACGCTGGCATTTCTCGAGAAATGCCAGCGTTCCCGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-1112s1c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006712.3-710s1c1
Sequence:CCGGAGGGTTGGAAGCTGCTCTAAGCTCGAGCTTAGAGCAGCTTCCAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1294s21c1
Sequence:CCGGACAGTCACAAGGACATAGTAGCTCGAGCTACTATGTCCTTGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-1112s21c1
Sequence:CCGGCCCTGGCTTCATCAACTACATCTCGAGATGTAGTTGATGAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-580s21c1
Sequence:CCGGGTCTGCACCTTGCAGTCTTACCTCGAGGTAAGACTGCAAGGTGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-525s21c1
Sequence:CCGGAGTCAGCTCATCATCCGAAACCTCGAGGTTTCGGATGATGAGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-1037s21c1
Sequence:CCGGGGCTACAGTCAACATCTTGATCTCGAGATCAAGATGTTGACTGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006712.3-893s21c1
Sequence:CCGGGGTGGTTCAGGAAACGCAACTCTCGAGAGTTGCGTTTCCTGAACCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006712.3-749s21c1
Sequence:CCGGGTATCCACGGCAGCATCTGATCTCGAGATCAGATGCTGCCGTGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023229
VALIDATED
FASTK MISSION shRNA Bacterial Glycerol Stock
Fas-activated serine/threonine kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1038s1c1
Sequence:CCGGGCTACCTCTCTCTACTCGATACTCGAGTATCGAGTAGAGAGAGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-564s1c1
Sequence:CCGGCTGCCATCTATGGTGGTCAAACTCGAGTTTGACCACCATAGATGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1349s1c1
Sequence:CCGGCAACAGGACCAGGCAAACTTTCTCGAGAAAGTTTGCCTGGTCCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-851s1c1
Sequence:CCGGCAGCAATTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAATTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-461s1c1
Sequence:CCGGCTTGCAGTGTTACTTGGCTTTCTCGAGAAAGCCAAGTAACACTGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1144s21c1
Sequence:CCGGCTACCTCTCTCTACTCGATACCTCGAGGTATCGAGTAGAGAGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-775s21c1
Sequence:CCGGAGAACTGACTCCTCACGTAATCTCGAGATTACGTGAGGAGTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-670s21c1
Sequence:CCGGTGCCATCTATGGTGGTCAAAGCTCGAGCTTTGACCACCATAGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1456s21c1
Sequence:CCGGACAGGACCAGGCAAACTTTAACTCGAGTTAAAGTTTGCCTGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-847s21c1
Sequence:CCGGTCTGGAAGCCATTGCTCATTTCTCGAGAAATGAGCAATGGCTTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023229
VALIDATED
FASTK MISSION shRNA shRNA Plasmid DNA
Fas-activated serine/threonine kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1038s1c1
Sequence:CCGGGCTACCTCTCTCTACTCGATACTCGAGTATCGAGTAGAGAGAGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-564s1c1
Sequence:CCGGCTGCCATCTATGGTGGTCAAACTCGAGTTTGACCACCATAGATGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1349s1c1
Sequence:CCGGCAACAGGACCAGGCAAACTTTCTCGAGAAAGTTTGCCTGGTCCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-851s1c1
Sequence:CCGGCAGCAATTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAATTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-461s1c1
Sequence:CCGGCTTGCAGTGTTACTTGGCTTTCTCGAGAAAGCCAAGTAACACTGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1144s21c1
Sequence:CCGGCTACCTCTCTCTACTCGATACCTCGAGGTATCGAGTAGAGAGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-775s21c1
Sequence:CCGGAGAACTGACTCCTCACGTAATCTCGAGATTACGTGAGGAGTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-670s21c1
Sequence:CCGGTGCCATCTATGGTGGTCAAAGCTCGAGCTTTGACCACCATAGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1456s21c1
Sequence:CCGGACAGGACCAGGCAAACTTTAACTCGAGTTAAAGTTTGCCTGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-847s21c1
Sequence:CCGGTCTGGAAGCCATTGCTCATTTCTCGAGAAATGAGCAATGGCTTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023229
VALIDATED
FASTK MISSION shRNA Lentiviral Transduction Particles
Fas-activated serine/threonine kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1038s1c1
Sequence:CCGGGCTACCTCTCTCTACTCGATACTCGAGTATCGAGTAGAGAGAGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-564s1c1
Sequence:CCGGCTGCCATCTATGGTGGTCAAACTCGAGTTTGACCACCATAGATGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-1349s1c1
Sequence:CCGGCAACAGGACCAGGCAAACTTTCTCGAGAAAGTTTGCCTGGTCCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023229.1-851s1c1
Sequence:CCGGCAGCAATTTATGCCCTGCCTTCTCGAGAAGGCAGGGCATAAATTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023229.1-461s1c1
Sequence:CCGGCTTGCAGTGTTACTTGGCTTTCTCGAGAAAGCCAAGTAACACTGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1144s21c1
Sequence:CCGGCTACCTCTCTCTACTCGATACCTCGAGGTATCGAGTAGAGAGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-775s21c1
Sequence:CCGGAGAACTGACTCCTCACGTAATCTCGAGATTACGTGAGGAGTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-670s21c1
Sequence:CCGGTGCCATCTATGGTGGTCAAAGCTCGAGCTTTGACCACCATAGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-1456s21c1
Sequence:CCGGACAGGACCAGGCAAACTTTAACTCGAGTTAAAGTTTGCCTGGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023229.2-847s21c1
Sequence:CCGGTCTGGAAGCCATTGCTCATTTCTCGAGAAATGAGCAATGGCTTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)