EMAIL THIS PAGE TO A FRIEND

FASTKD1

FAST kinase domains 1

70 Gene Product Result for
UniProtKB ID: Q53R41, Q8N583, Q8TEA9, Q96JM5, Q96N71, Q9H6T4
Gene ID:
Mouse(320720) FAST kinase domains 1
Rat(311112) FAST kinase domains 1
domestic guinea pig(100712784) FAST kinase domains 1
naked mole-rat(101720931) FAST kinase domains 1
sheep(101120053) FAST kinase domains 1
Zebrafish(100148546) FAST kinase domains 1
cow(515744) FAST kinase domains 1
domestic cat(101088097) FAST kinase domains 1
dog(478785) FAST kinase domains 1
chicken(424163) FAST kinase domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024622 Rosetta Predictions human pricing
XM_230003 Rosetta Predictions rat pricing
XR_007690 Rosetta Predictions rat pricing
NM_177244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141358 predicted 2016
2 SASI_Hs02_00356999 predicted 2371
3 SASI_Hs02_00357000 predicted 2310
4 SASI_Hs01_00141359 predicted 1080
5 SASI_Hs01_00141360 predicted 1114
6 SASI_Hs01_00141361 predicted 1868
7 SASI_Hs01_00141362 predicted 1494
8 SASI_Hs01_00141363 predicted 2511
9 SASI_Hs02_00357001 predicted 2131
10 SASI_Hs02_00357002 predicted 1721
11 SASI_Hs01_00141364 predicted 387
12 SASI_Hs01_00141365 predicted 2030
13 SASI_Hs01_00141366 predicted 2264
14 SASI_Hs01_00141367 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386072 predicted 980
2 SASI_Rn02_00386073 predicted 543
3 SASI_Rn02_00386074 predicted 817
4 SASI_Rn02_00386075 predicted 466
5 SASI_Rn02_00386076 predicted 666
6 SASI_Rn02_00386077 predicted 566
7 SASI_Rn02_00386078 predicted 1011
8 SASI_Rn02_00386079 predicted 605
9 SASI_Rn02_00386080 predicted 657
10 SASI_Rn02_00386081 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415210 predicted 2164
2 SASI_Rn02_00415211 predicted 2005
3 SASI_Rn02_00415212 predicted 2179
4 SASI_Rn02_00415213 predicted 2409
5 SASI_Rn02_00415214 predicted 2427
6 SASI_Rn02_00415215 predicted 2087
7 SASI_Rn02_00415216 predicted 2353
8 SASI_Rn02_00415217 predicted 2579
9 SASI_Rn02_00415218 predicted 2105
10 SASI_Rn02_00415219 predicted 1926
11 SASI_Rn01_00190436 predicted 1219
12 SASI_Rn01_00190437 predicted 705
13 SASI_Rn01_00190438 predicted 1014
14 SASI_Rn01_00190439 predicted 986
15 SASI_Rn01_00190440 predicted 828
16 SASI_Rn01_00190441 predicted 1615
17 SASI_Rn01_00190442 predicted 473
18 SASI_Rn01_00190443 predicted 1168
19 SASI_Rn01_00190444 predicted 611
20 SASI_Rn01_00190445 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347283 predicted 695
2 SASI_Mm01_00149552 predicted 911
3 SASI_Mm01_00149553 predicted 393
4 SASI_Mm01_00149554 predicted 497
5 SASI_Mm01_00149555 predicted 1001
6 SASI_Mm01_00149556 predicted 1229
7 SASI_Mm02_00347284 predicted 1396
8 SASI_Mm01_00149557 predicted 549
9 SASI_Mm01_00149558 predicted 845
10 SASI_Mm01_00149559 predicted 2331
11 SASI_Mm01_00149560 predicted 1926
12 SASI_Mm01_00149561 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024622
VALIDATED
FASTKD1 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024622.3-2435s21c1
Sequence:GTACCGGGACCGCTTCTGTCAACAATATCTCGAGATATTGTTGACAGAAGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-1638s21c1
Sequence:CCGGCTGTTCTGGTCCGTGCTATTTCTCGAGAAATAGCACGGACCAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2117s21c1
Sequence:CCGGATTCGTCCATTCAGCGTATTGCTCGAGCAATACGCTGAATGGACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2546s21c1
Sequence:CCGGTCGGTTCTTACGCCTTATTACCTCGAGGTAATAAGGCGTAAGAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2664s21c1
Sequence:CCGGGGGAATCAAATATCGAAATAGCTCGAGCTATTTCGATATTTGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2614s21c1
Sequence:CCGGTCCGTATGGAAGCCATAATATCTCGAGATATTATGGCTTCCATACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2174s21c1
Sequence:GTACCGGACTTGCGTGCAACATCTTAATCTCGAGATTAAGATGTTGCACGCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2514s21c1
Sequence:GTACCGGAGGTACTAGGAGGAATCAATTCTCGAGAATTGATTCCTCCTAGTACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-862s1c1
Sequence:CCGGCTTGTCTGTCTTGATGGTCAACTCGAGTTGACCATCAAGACAGACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-770s1c1
Sequence:CCGGCTAGCAGATCAGCATTTGTATCTCGAGATACAAATGCTGATCTGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-1931s1c1
Sequence:CCGGCTCAGTACTTTGCTACTAGATCTCGAGATCTAGTAGCAAAGTACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-2734s1c1
Sequence:CCGGCCAGTTTGAATGGAACTCTATCTCGAGATAGAGTTCCATTCAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024622.2-2335s1c1
Sequence:CCGGCCGCTTCTGTCAACAATATAACTCGAGTTATATTGTTGACAGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024622
VALIDATED
FASTKD1 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024622.3-2435s21c1
Sequence:GTACCGGGACCGCTTCTGTCAACAATATCTCGAGATATTGTTGACAGAAGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-1638s21c1
Sequence:CCGGCTGTTCTGGTCCGTGCTATTTCTCGAGAAATAGCACGGACCAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2117s21c1
Sequence:CCGGATTCGTCCATTCAGCGTATTGCTCGAGCAATACGCTGAATGGACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2546s21c1
Sequence:CCGGTCGGTTCTTACGCCTTATTACCTCGAGGTAATAAGGCGTAAGAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2664s21c1
Sequence:CCGGGGGAATCAAATATCGAAATAGCTCGAGCTATTTCGATATTTGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2614s21c1
Sequence:CCGGTCCGTATGGAAGCCATAATATCTCGAGATATTATGGCTTCCATACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2174s21c1
Sequence:GTACCGGACTTGCGTGCAACATCTTAATCTCGAGATTAAGATGTTGCACGCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2514s21c1
Sequence:GTACCGGAGGTACTAGGAGGAATCAATTCTCGAGAATTGATTCCTCCTAGTACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-862s1c1
Sequence:CCGGCTTGTCTGTCTTGATGGTCAACTCGAGTTGACCATCAAGACAGACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-770s1c1
Sequence:CCGGCTAGCAGATCAGCATTTGTATCTCGAGATACAAATGCTGATCTGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-1931s1c1
Sequence:CCGGCTCAGTACTTTGCTACTAGATCTCGAGATCTAGTAGCAAAGTACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-2734s1c1
Sequence:CCGGCCAGTTTGAATGGAACTCTATCTCGAGATAGAGTTCCATTCAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024622.2-2335s1c1
Sequence:CCGGCCGCTTCTGTCAACAATATAACTCGAGTTATATTGTTGACAGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024622
VALIDATED
FASTKD1 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024622.3-2435s21c1
Sequence:GTACCGGGACCGCTTCTGTCAACAATATCTCGAGATATTGTTGACAGAAGCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-1638s21c1
Sequence:CCGGCTGTTCTGGTCCGTGCTATTTCTCGAGAAATAGCACGGACCAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2117s21c1
Sequence:CCGGATTCGTCCATTCAGCGTATTGCTCGAGCAATACGCTGAATGGACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2546s21c1
Sequence:CCGGTCGGTTCTTACGCCTTATTACCTCGAGGTAATAAGGCGTAAGAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2664s21c1
Sequence:CCGGGGGAATCAAATATCGAAATAGCTCGAGCTATTTCGATATTTGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2614s21c1
Sequence:CCGGTCCGTATGGAAGCCATAATATCTCGAGATATTATGGCTTCCATACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2174s21c1
Sequence:GTACCGGACTTGCGTGCAACATCTTAATCTCGAGATTAAGATGTTGCACGCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024622.3-2514s21c1
Sequence:GTACCGGAGGTACTAGGAGGAATCAATTCTCGAGAATTGATTCCTCCTAGTACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-862s1c1
Sequence:CCGGCTTGTCTGTCTTGATGGTCAACTCGAGTTGACCATCAAGACAGACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024622.2-770s1c1
Sequence:CCGGCTAGCAGATCAGCATTTGTATCTCGAGATACAAATGCTGATCTGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-1931s1c1
Sequence:CCGGCTCAGTACTTTGCTACTAGATCTCGAGATCTAGTAGCAAAGTACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024622.2-2734s1c1
Sequence:CCGGCCAGTTTGAATGGAACTCTATCTCGAGATAGAGTTCCATTCAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024622.2-2335s1c1
Sequence:CCGGCCGCTTCTGTCAACAATATAACTCGAGTTATATTGTTGACAGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177244
VALIDATED
FASTKD1 MISSION shRNA Bacterial Glycerol Stock
FAST kinase domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-557s21c1
Sequence:CCGGACTAATGTGCTGTCCATATTTCTCGAGAAATATGGACAGCACATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-302s21c1
Sequence:CCGGCAAGTGGGCTGTGCGTTTAATCTCGAGATTAAACGCACAGCCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177244.3-2263s21c1
Sequence:CCGGTTCCGCTCTTTCACCGTATTACTCGAGTAATACGGTGAAAGAGCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-200s21c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-2701s21c1
Sequence:CCGGCTGCTCTTGCAGAGATCCTAACTCGAGTTAGGATCTCTGCAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-2952s1c1
Sequence:CCGGGCAGGGATATGGAAGAAGCAACTCGAGTTGCTTCTTCCATATCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177244.2-1220s1c1
Sequence:CCGGGCTGTGCGTTTAATGTACTTTCTCGAGAAAGTACATTAAACGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-3005s1c1
Sequence:CCGGGCGAACAACATTGTGGAGCATCTCGAGATGCTCCACAATGTTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1111s1c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1170s1c1
Sequence:CCGGGTTTGACCTTATTGAGACGAACTCGAGTTCGTCTCAATAAGGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177244
VALIDATED
FASTKD1 MISSION shRNA shRNA Plasmid DNA
FAST kinase domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-557s21c1
Sequence:CCGGACTAATGTGCTGTCCATATTTCTCGAGAAATATGGACAGCACATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-302s21c1
Sequence:CCGGCAAGTGGGCTGTGCGTTTAATCTCGAGATTAAACGCACAGCCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177244.3-2263s21c1
Sequence:CCGGTTCCGCTCTTTCACCGTATTACTCGAGTAATACGGTGAAAGAGCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-200s21c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-2701s21c1
Sequence:CCGGCTGCTCTTGCAGAGATCCTAACTCGAGTTAGGATCTCTGCAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-2952s1c1
Sequence:CCGGGCAGGGATATGGAAGAAGCAACTCGAGTTGCTTCTTCCATATCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177244.2-1220s1c1
Sequence:CCGGGCTGTGCGTTTAATGTACTTTCTCGAGAAAGTACATTAAACGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-3005s1c1
Sequence:CCGGGCGAACAACATTGTGGAGCATCTCGAGATGCTCCACAATGTTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1111s1c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1170s1c1
Sequence:CCGGGTTTGACCTTATTGAGACGAACTCGAGTTCGTCTCAATAAGGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177244
VALIDATED
FASTKD1 MISSION shRNA Lentiviral Transduction Particles
FAST kinase domains 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-557s21c1
Sequence:CCGGACTAATGTGCTGTCCATATTTCTCGAGAAATATGGACAGCACATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-302s21c1
Sequence:CCGGCAAGTGGGCTGTGCGTTTAATCTCGAGATTAAACGCACAGCCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177244.3-2263s21c1
Sequence:CCGGTTCCGCTCTTTCACCGTATTACTCGAGTAATACGGTGAAAGAGCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-200s21c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177244.3-2701s21c1
Sequence:CCGGCTGCTCTTGCAGAGATCCTAACTCGAGTTAGGATCTCTGCAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-2952s1c1
Sequence:CCGGGCAGGGATATGGAAGAAGCAACTCGAGTTGCTTCTTCCATATCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177244.2-1220s1c1
Sequence:CCGGGCTGTGCGTTTAATGTACTTTCTCGAGAAAGTACATTAAACGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177244.2-3005s1c1
Sequence:CCGGGCGAACAACATTGTGGAGCATCTCGAGATGCTCCACAATGTTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1111s1c1
Sequence:CCGGCCCTTCAGTTGTGAGTCATTACTCGAGTAATGACTCACAACTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177244.2-1170s1c1
Sequence:CCGGGTTTGACCTTATTGAGACGAACTCGAGTTCGTCTCAATAAGGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)