EMAIL THIS PAGE TO A FRIEND

FBP2

fructose-1,6-bisphosphatase 2

59 Gene Product Result for
UniProtKB ID: O00757, Q17R39, Q6FI53
Gene ID:
Human(8789) Summary: This gene encodes a gluconeogenesis regulatory enzyme which catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. [provided by RefSeq, Jul 2008]
Mouse(14120) fructose bisphosphatase 2
Rat(114508) fructose-1,6-bisphosphatase 2
Zebrafish(445505) fructose-1,6-bisphosphatase 2
chicken(395217) fructose-1,6-bisphosphatase 2
fruit fly(34259) Fat body protein 2
dog(476300) fructose-1,6-bisphosphatase 2
domestic cat(101084578) fructose-1,6-bisphosphatase 2
Horse(100061491) fructose-1,6-bisphosphatase 2
cow(514066) fructose-1,6-bisphosphatase 2
sheep(101113460) fructose-1,6-bisphosphatase 2
Domestic Rabbit(100008853) fructose-1,6-bisphosphatase 2
domestic guinea pig(100732473) fructose-1,6-bisphosphatase 2
naked mole-rat(101707693) fructose-1,6-bisphosphatase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003837 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003837 Rosetta Predictions human pricing
NM_053716 Rosetta Predictions rat pricing
NM_007994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092487 predicted 519
2 SASI_Hs01_00092488 predicted 465
3 SASI_Hs01_00092489 predicted 554
4 SASI_Hs01_00092490 predicted 236
5 SASI_Hs01_00092491 predicted 292
6 SASI_Hs01_00092492 predicted 399
7 SASI_Hs01_00092493 predicted 416
8 SASI_Hs02_00336407 predicted 468
9 SASI_Hs01_00092495 predicted 490
10 SASI_Hs01_00092496 predicted 574
11 SASI_Hs01_00092494 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094139 predicted 654
2 SASI_Rn01_00094140 predicted 632
3 SASI_Rn01_00094142 predicted 444
4 SASI_Rn01_00094143 predicted 547
5 SASI_Rn01_00094144 predicted 482
6 SASI_Rn01_00094145 predicted 408
7 SASI_Rn01_00094146 predicted 954
8 SASI_Rn02_00266480 predicted 489
9 SASI_Rn01_00094147 predicted 562
10 SASI_Rn01_00094148 predicted 652
11 SASI_Rn01_00094141 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120847 predicted 554
2 SASI_Mm01_00120848 predicted 426
3 SASI_Mm01_00120849 predicted 640
4 SASI_Mm01_00120851 predicted 472
5 SASI_Mm01_00120852 predicted 430
6 SASI_Mm02_00312916 predicted 980
7 SASI_Mm02_00312917 predicted 504
8 SASI_Mm01_00120853 predicted 344
9 SASI_Mm01_00120854 predicted 300
10 SASI_Mm02_00312918 predicted 589
11 SASI_Mm01_00120850 predicted 624
12 SASI_Mm01_00120855 predicted 867
13 SASI_Mm01_00120856 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007994
FBP2 MISSION shRNA Bacterial Glycerol Stock
fructose-1,6-bisphosphatase 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-737s21c1
Sequence:CCGGGCTGCTACTGCTGAGTATGTACTCGAGTACATACTCAGCAGTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-109s21c1
Sequence:CCGGGACCCTGACCCGTTACGTTATCTCGAGATAACGTAACGGGTCAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-623s1c1
Sequence:CCGGCGGATTAAGAAGAAAGGGAAACTCGAGTTTCCCTTTCTTCTTAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-818s1c1
Sequence:CCGGGCCAACCAGAAGAGTCCTAATCTCGAGATTAGGACTCTTCTGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-848s1c1
Sequence:CCGGCGGCTCCTGTATGAATGCAATCTCGAGATTGCATTCATACAGGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007994.1-1091s1c1
Sequence:CCGGAGATGAATGAGCTATGGAGATCTCGAGATCTCCATAGCTCATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-982s1c1
Sequence:CCGGCCTGAGGATGTGCAAGAGTATCTCGAGATACTCTTGCACATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007994
FBP2 MISSION shRNA shRNA Plasmid DNA
fructose-1,6-bisphosphatase 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-737s21c1
Sequence:CCGGGCTGCTACTGCTGAGTATGTACTCGAGTACATACTCAGCAGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-109s21c1
Sequence:CCGGGACCCTGACCCGTTACGTTATCTCGAGATAACGTAACGGGTCAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-623s1c1
Sequence:CCGGCGGATTAAGAAGAAAGGGAAACTCGAGTTTCCCTTTCTTCTTAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-818s1c1
Sequence:CCGGGCCAACCAGAAGAGTCCTAATCTCGAGATTAGGACTCTTCTGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-848s1c1
Sequence:CCGGCGGCTCCTGTATGAATGCAATCTCGAGATTGCATTCATACAGGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007994.1-1091s1c1
Sequence:CCGGAGATGAATGAGCTATGGAGATCTCGAGATCTCCATAGCTCATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-982s1c1
Sequence:CCGGCCTGAGGATGTGCAAGAGTATCTCGAGATACTCTTGCACATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007994
FBP2 MISSION shRNA Lentiviral Transduction Particles
fructose-1,6-bisphosphatase 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-737s21c1
Sequence:CCGGGCTGCTACTGCTGAGTATGTACTCGAGTACATACTCAGCAGTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007994.3-109s21c1
Sequence:CCGGGACCCTGACCCGTTACGTTATCTCGAGATAACGTAACGGGTCAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-623s1c1
Sequence:CCGGCGGATTAAGAAGAAAGGGAAACTCGAGTTTCCCTTTCTTCTTAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-818s1c1
Sequence:CCGGGCCAACCAGAAGAGTCCTAATCTCGAGATTAGGACTCTTCTGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-848s1c1
Sequence:CCGGCGGCTCCTGTATGAATGCAATCTCGAGATTGCATTCATACAGGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007994.1-1091s1c1
Sequence:CCGGAGATGAATGAGCTATGGAGATCTCGAGATCTCCATAGCTCATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007994.1-982s1c1
Sequence:CCGGCCTGAGGATGTGCAAGAGTATCTCGAGATACTCTTGCACATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003837
FBP2 MISSION shRNA Bacterial Glycerol Stock
fructose-1,6-bisphosphatase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1137s21c1
Sequence:GTACCGGGGACCCTAAATGAACGATAAACTCGAGTTTATCGTTCATTTAGGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-915s21c1
Sequence:CCGGATCCCGTGGCCTACATCATTGCTCGAGCAATGATGTAGGCCACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-242s21c1
Sequence:CCGGGGAATCGCAGGAAGCGTTAACCTCGAGGTTAACGCTTCCTGCGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1160s21c1
Sequence:CCGGGAGATGGTAGCTATGAGTATACTCGAGTATACTCATAGCTACCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-428s21c1
Sequence:CCGGCTGGATGGATCTTCCAATATTCTCGAGAATATTGGAAGATCCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-729s21c1
Sequence:CCGGATGCGGCCACCACTGAATATGCTCGAGCATATTCAGTGGTGGCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-735s1c1
Sequence:CCGGCCACCACTGAATATGTGCAGACTCGAGTCTGCACATATTCAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-1031s1c1
Sequence:CCGGCCAGAGGATGTGCAGGAATATCTCGAGATATTCCTGCACATCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-841s1c1
Sequence:CCGGCTATGGAGGAATCTTCCTGTACTCGAGTACAGGAAGATTCCTCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-466s1c1
Sequence:CCGGCGGAACCATCTTTGCCATCTACTCGAGTAGATGGCAAAGATGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-528s21c1
Sequence:CCGGTGCAGTGTGGCCGCAATATTGCTCGAGCAATATTGCGGCCACACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-706s21c1
Sequence:CCGGTGAGGGCTATGCCAAGTATTTCTCGAGAAATACTTGGCATAGCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003837
FBP2 MISSION shRNA shRNA Plasmid DNA
fructose-1,6-bisphosphatase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1137s21c1
Sequence:GTACCGGGGACCCTAAATGAACGATAAACTCGAGTTTATCGTTCATTTAGGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-915s21c1
Sequence:CCGGATCCCGTGGCCTACATCATTGCTCGAGCAATGATGTAGGCCACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-242s21c1
Sequence:CCGGGGAATCGCAGGAAGCGTTAACCTCGAGGTTAACGCTTCCTGCGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1160s21c1
Sequence:CCGGGAGATGGTAGCTATGAGTATACTCGAGTATACTCATAGCTACCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-428s21c1
Sequence:CCGGCTGGATGGATCTTCCAATATTCTCGAGAATATTGGAAGATCCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-729s21c1
Sequence:CCGGATGCGGCCACCACTGAATATGCTCGAGCATATTCAGTGGTGGCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-735s1c1
Sequence:CCGGCCACCACTGAATATGTGCAGACTCGAGTCTGCACATATTCAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-1031s1c1
Sequence:CCGGCCAGAGGATGTGCAGGAATATCTCGAGATATTCCTGCACATCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-841s1c1
Sequence:CCGGCTATGGAGGAATCTTCCTGTACTCGAGTACAGGAAGATTCCTCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-466s1c1
Sequence:CCGGCGGAACCATCTTTGCCATCTACTCGAGTAGATGGCAAAGATGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-528s21c1
Sequence:CCGGTGCAGTGTGGCCGCAATATTGCTCGAGCAATATTGCGGCCACACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-706s21c1
Sequence:CCGGTGAGGGCTATGCCAAGTATTTCTCGAGAAATACTTGGCATAGCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003837
FBP2 MISSION shRNA Lentiviral Transduction Particles
fructose-1,6-bisphosphatase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1137s21c1
Sequence:GTACCGGGGACCCTAAATGAACGATAAACTCGAGTTTATCGTTCATTTAGGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-915s21c1
Sequence:CCGGATCCCGTGGCCTACATCATTGCTCGAGCAATGATGTAGGCCACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-242s21c1
Sequence:CCGGGGAATCGCAGGAAGCGTTAACCTCGAGGTTAACGCTTCCTGCGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003837.2-1160s21c1
Sequence:CCGGGAGATGGTAGCTATGAGTATACTCGAGTATACTCATAGCTACCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-428s21c1
Sequence:CCGGCTGGATGGATCTTCCAATATTCTCGAGAATATTGGAAGATCCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-729s21c1
Sequence:CCGGATGCGGCCACCACTGAATATGCTCGAGCATATTCAGTGGTGGCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-735s1c1
Sequence:CCGGCCACCACTGAATATGTGCAGACTCGAGTCTGCACATATTCAGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-1031s1c1
Sequence:CCGGCCAGAGGATGTGCAGGAATATCTCGAGATATTCCTGCACATCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-841s1c1
Sequence:CCGGCTATGGAGGAATCTTCCTGTACTCGAGTACAGGAAGATTCCTCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003837.2-466s1c1
Sequence:CCGGCGGAACCATCTTTGCCATCTACTCGAGTAGATGGCAAAGATGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-528s21c1
Sequence:CCGGTGCAGTGTGGCCGCAATATTGCTCGAGCAATATTGCGGCCACACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003837.2-706s21c1
Sequence:CCGGTGAGGGCTATGCCAAGTATTTCTCGAGAAATACTTGGCATAGCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)