EMAIL THIS PAGE TO A FRIEND

FBRSL1

fibrosin-like 1

105 Gene Product Result for
UniProtKB ID: Q9HCM7, Q86XQ1
Gene ID:
Mouse(381668) fibrosin-like 1
Rat(304572) fibrosin-like 1
sheep(101116937) fibrosin-like 1
naked mole-rat(101703214) fibrosin-like 1
Zebrafish(557358) fibrosin-like 1
cow(785549) fibrosin-like 1
domestic cat(101097424) fibrosin-like 1
dog(609829) fibrosin-like 1
chicken(416793) fibrosin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001142641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716046 Rosetta Predictions human pricing
XM_495939 Rosetta Predictions human pricing
XM_936428 Rosetta Predictions human pricing
XM_001080689 Rosetta Predictions rat pricing
XM_222254 Rosetta Predictions rat pricing
NM_028596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407819 predicted 272
2 SASI_Hs02_00407820 predicted 609
3 SASI_Hs02_00407821 predicted 1992
4 SASI_Hs02_00407822 predicted 2161
5 SASI_Hs02_00407823 predicted 328
6 SASI_Hs02_00407824 predicted 1870
7 SASI_Hs02_00407825 predicted 2031
8 SASI_Hs02_00407826 predicted 2166
9 SASI_Hs02_00407827 predicted 1875
10 SASI_Hs02_00407828 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280721 predicted 1759
2 SASI_Hs02_00479931 predicted 1789
3 SASI_Hs01_00280723 predicted 1822
4 SASI_Hs01_00280727 predicted 1819
5 SASI_Hs02_00479932 predicted 1907
6 SASI_Hs02_00479933 predicted 1760
7 SASI_Hs02_00479934 predicted 1910
8 SASI_Hs02_00479935 predicted 1761
9 SASI_Hs02_00479936 predicted 1825
10 SASI_Hs02_00479937 predicted 1944
11 SASI_Hs01_00280719 predicted 1471
12 SASI_Hs01_00280720 predicted 1582
13 SASI_Hs01_00280722 predicted 1642
14 SASI_Hs01_00280724 predicted 1520
15 SASI_Hs01_00280725 predicted 1685
16 SASI_Hs01_00280726 predicted 1463
17 SASI_Hs01_00280728 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482069 predicted 1211
2 SASI_Hs02_00482070 predicted 267
3 SASI_Hs02_00482071 predicted 1080
4 SASI_Hs02_00482072 predicted 1523
5 SASI_Hs02_00482073 predicted 1693
6 SASI_Hs02_00482074 predicted 1046
7 SASI_Hs02_00482075 predicted 1697
8 SASI_Hs02_00482076 predicted 1631
9 SASI_Hs02_00482077 predicted 1055
10 SASI_Hs02_00482078 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368950 predicted 1554
2 SASI_Rn02_00368951 predicted 1705
3 SASI_Rn02_00368952 predicted 1739
4 SASI_Rn02_00368953 predicted 1571
5 SASI_Rn02_00368954 predicted 2427
6 SASI_Rn02_00368955 predicted 1977
7 SASI_Rn02_00368956 predicted 1875
8 SASI_Rn02_00368957 predicted 1547
9 SASI_Rn02_00368958 predicted 1728
10 SASI_Rn02_00368959 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380685 predicted 3051
2 SASI_Rn02_00380686 predicted 3065
3 SASI_Rn02_00380687 predicted 3694
4 SASI_Rn02_00380688 predicted 1084
5 SASI_Rn02_00380689 predicted 1427
6 SASI_Rn02_00380690 predicted 3923
7 SASI_Rn02_00380691 predicted 3828
8 SASI_Rn02_00380692 predicted 2269
9 SASI_Rn02_00380693 predicted 3505
10 SASI_Rn02_00380694 predicted 3677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043421 predicted 2481
2 SASI_Mm01_00043423 predicted 1152
3 SASI_Mm01_00043424 predicted 1169
4 SASI_Mm01_00043425 predicted 1626
5 SASI_Mm01_00043427 predicted 2111
6 SASI_Mm01_00043429 predicted 1301
7 SASI_Mm02_00334073 predicted 1766
8 SASI_Mm02_00334074 predicted 1998
9 SASI_Mm02_00334075 predicted 1391
10 SASI_Mm02_00334076 predicted 1429
11 SASI_Mm01_00043422 predicted 1586
12 SASI_Mm01_00043426 predicted 1311
13 SASI_Mm01_00043428 predicted 1779
14 SASI_Mm01_00043430 predicted 2219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028596
FBRSL1 MISSION shRNA Bacterial Glycerol Stock
fibrosin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1042s1c1
Sequence:CCGGGTCGAGAGCAGTTCACACTTTCTCGAGAAAGTGTGAACTGCTCTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1009s1c1
Sequence:CCGGCAACACTTCAAACTCAATCGACTCGAGTCGATTGAGTTTGAAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028596.1-1023s1c1
Sequence:CCGGCAATCGAAATAACAGGCCGGTCTCGAGACCGGCCTGTTATTTCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1012s1c1
Sequence:CCGGCACTTCAAACTCAATCGAAATCTCGAGATTTCGATTGAGTTTGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1763s1c1
Sequence:CCGGCACTCACCTAGCAAAGAGGATCTCGAGATCCTCTTTGCTAGGTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1969s1c1
Sequence:CCGGGCACTCCACAGCTACACATATCTCGAGATATGTGTAGCTGTGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-2977s1c1
Sequence:CCGGGCATAGTTGTAAGAGGATTTCCTCGAGGAAATCCTCTTACAACTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-3603s1c1
Sequence:CCGGGTTCTCAACCAGCACATTTATCTCGAGATAAATGTGCTGGTTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028596
FBRSL1 MISSION shRNA shRNA Plasmid DNA
fibrosin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1042s1c1
Sequence:CCGGGTCGAGAGCAGTTCACACTTTCTCGAGAAAGTGTGAACTGCTCTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1009s1c1
Sequence:CCGGCAACACTTCAAACTCAATCGACTCGAGTCGATTGAGTTTGAAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028596.1-1023s1c1
Sequence:CCGGCAATCGAAATAACAGGCCGGTCTCGAGACCGGCCTGTTATTTCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1012s1c1
Sequence:CCGGCACTTCAAACTCAATCGAAATCTCGAGATTTCGATTGAGTTTGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1763s1c1
Sequence:CCGGCACTCACCTAGCAAAGAGGATCTCGAGATCCTCTTTGCTAGGTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1969s1c1
Sequence:CCGGGCACTCCACAGCTACACATATCTCGAGATATGTGTAGCTGTGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-2977s1c1
Sequence:CCGGGCATAGTTGTAAGAGGATTTCCTCGAGGAAATCCTCTTACAACTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-3603s1c1
Sequence:CCGGGTTCTCAACCAGCACATTTATCTCGAGATAAATGTGCTGGTTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028596
FBRSL1 MISSION shRNA Lentiviral Transduction Particles
fibrosin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1042s1c1
Sequence:CCGGGTCGAGAGCAGTTCACACTTTCTCGAGAAAGTGTGAACTGCTCTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1009s1c1
Sequence:CCGGCAACACTTCAAACTCAATCGACTCGAGTCGATTGAGTTTGAAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028596.1-1023s1c1
Sequence:CCGGCAATCGAAATAACAGGCCGGTCTCGAGACCGGCCTGTTATTTCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1012s1c1
Sequence:CCGGCACTTCAAACTCAATCGAAATCTCGAGATTTCGATTGAGTTTGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1763s1c1
Sequence:CCGGCACTCACCTAGCAAAGAGGATCTCGAGATCCTCTTTGCTAGGTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028596.1-1969s1c1
Sequence:CCGGGCACTCCACAGCTACACATATCTCGAGATATGTGTAGCTGTGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-2977s1c1
Sequence:CCGGGCATAGTTGTAAGAGGATTTCCTCGAGGAAATCCTCTTACAACTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028596.2-3603s1c1
Sequence:CCGGGTTCTCAACCAGCACATTTATCTCGAGATAAATGTGCTGGTTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142641
VALIDATED
FBRSL1 MISSION shRNA Bacterial Glycerol Stock
fibrosin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1233s21c1
Sequence:CCGGAGAGCTGAACACGCGGTTTCTCTCGAGAGAAACCGCGTGTTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001142641.1-1471s21c1
Sequence:CCGGCGACATTCCAGCGTGAGTTTCCTCGAGGAAACTCACGCTGGAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142641.1-3413s21c1
Sequence:CCGGTATGCTCTTTAGACGTTTAAACTCGAGTTTAAACGTCTAAAGAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1973s21c1
Sequence:CCGGATCCTGCCTCCAACCCATTTGCTCGAGCAAATGGGTTGGAGGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-653s21c1
Sequence:CCGGTGGGCTCTGAGAAGCTCTTTGCTCGAGCAAAGAGCTTCTCAGAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142641
VALIDATED
FBRSL1 MISSION shRNA shRNA Plasmid DNA
fibrosin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1233s21c1
Sequence:CCGGAGAGCTGAACACGCGGTTTCTCTCGAGAGAAACCGCGTGTTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001142641.1-1471s21c1
Sequence:CCGGCGACATTCCAGCGTGAGTTTCCTCGAGGAAACTCACGCTGGAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142641.1-3413s21c1
Sequence:CCGGTATGCTCTTTAGACGTTTAAACTCGAGTTTAAACGTCTAAAGAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1973s21c1
Sequence:CCGGATCCTGCCTCCAACCCATTTGCTCGAGCAAATGGGTTGGAGGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-653s21c1
Sequence:CCGGTGGGCTCTGAGAAGCTCTTTGCTCGAGCAAAGAGCTTCTCAGAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142641
VALIDATED
FBRSL1 MISSION shRNA Lentiviral Transduction Particles
fibrosin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1233s21c1
Sequence:CCGGAGAGCTGAACACGCGGTTTCTCTCGAGAGAAACCGCGTGTTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001142641.1-1471s21c1
Sequence:CCGGCGACATTCCAGCGTGAGTTTCCTCGAGGAAACTCACGCTGGAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142641.1-3413s21c1
Sequence:CCGGTATGCTCTTTAGACGTTTAAACTCGAGTTTAAACGTCTAAAGAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-1973s21c1
Sequence:CCGGATCCTGCCTCCAACCCATTTGCTCGAGCAAATGGGTTGGAGGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142641.1-653s21c1
Sequence:CCGGTGGGCTCTGAGAAGCTCTTTGCTCGAGCAAAGAGCTTCTCAGAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)