EMAIL THIS PAGE TO A FRIEND

FBXL16

F-box and leucine-rich repeat protein 16

138 Gene Product Result for
Synonyms: C16orf22 Fbl16 c380A1.1
UniProtKB ID: Q8N461, D3DU60, Q2MHR2, Q96S14, Q9UJI0
Gene ID:
Human(146330) Summary: Members of the F-box protein family, such as FBXL16, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(214931) F-box and leucine-rich repeat protein 16
Rat(494223) F-box and leucine-rich repeat protein 16
sheep(101104365) F-box and leucine-rich repeat protein 16
naked mole-rat(101704583) F-box and leucine-rich repeat protein 16
domestic guinea pig(100718163) F-box and leucine-rich repeat protein 16
Zebrafish(797939) F-box and leucine-rich repeat protein 16
dog(490090) F-box and leucine-rich repeat protein 16
domestic cat(101092323) F-box and leucine-rich repeat protein 16
cow(789464) F-box and leucine-rich repeat protein 16
chicken(416405) F-box and leucine-rich repeat protein 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153350 Rosetta Predictions human pricing
NM_001009504 Rosetta Predictions rat pricing
XM_001479823 Rosetta Predictions mouse pricing
XM_001479825 Rosetta Predictions mouse pricing
XM_128530 Rosetta Predictions mouse pricing
XM_913601 Rosetta Predictions mouse pricing
XM_922828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109988 predicted 783
2 SASI_Hs01_00109990 predicted 829
3 SASI_Hs01_00109991 predicted 706
4 SASI_Hs01_00109992 predicted 1361
5 SASI_Hs01_00109993 predicted 1258
6 SASI_Hs01_00109994 predicted 731
7 SASI_Hs01_00109995 predicted 770
8 SASI_Hs01_00109996 predicted 1103
9 SASI_Hs01_00109997 predicted 1336
10 SASI_Hs02_00367212 predicted 1123
11 SASI_Hs01_00109989 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045452 predicted 551
2 SASI_Rn01_00045453 predicted 579
3 SASI_Rn01_00045455 predicted 895
4 SASI_Rn02_00199569 predicted 1158
5 SASI_Rn01_00045456 predicted 288
6 SASI_Rn01_00045457 predicted 284
7 SASI_Rn01_00045458 predicted 1030
8 SASI_Rn01_00045459 predicted 747
9 SASI_Rn01_00045460 predicted 278
10 SASI_Rn01_00045461 predicted 945
11 SASI_Rn01_00045454 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00412919 predicted 866
2 SASI_Mm02_00412920 predicted 664
3 SASI_Mm02_00412921 predicted 1428
4 SASI_Mm02_00412922 predicted 1135
5 SASI_Mm02_00412923 predicted 706
6 SASI_Mm02_00412924 predicted 1095
7 SASI_Mm02_00412925 predicted 1188
8 SASI_Mm02_00412926 predicted 404
9 SASI_Mm02_00412927 predicted 1183
10 SASI_Mm02_00412928 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00412929 predicted 1050
2 SASI_Mm02_00412930 predicted 849
3 SASI_Mm02_00412931 predicted 1612
4 SASI_Mm02_00412932 predicted 1313
5 SASI_Mm02_00412933 predicted 885
6 SASI_Mm02_00412934 predicted 1282
7 SASI_Mm02_00412935 predicted 1374
8 SASI_Mm02_00412936 predicted 592
9 SASI_Mm02_00412937 predicted 1194
10 SASI_Mm02_00412938 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424260 predicted 866
2 SASI_Mm02_00424261 predicted 661
3 SASI_Mm02_00424262 predicted 1423
4 SASI_Mm02_00424263 predicted 1130
5 SASI_Mm02_00424264 predicted 698
6 SASI_Mm02_00424265 predicted 1100
7 SASI_Mm02_00424266 predicted 1185
8 SASI_Mm02_00424267 predicted 400
9 SASI_Mm02_00424268 predicted 1185
10 SASI_Mm02_00424269 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281889 predicted 1056
2 SASI_Mm01_00281890 predicted 848
3 SASI_Mm01_00281891 predicted 1614
4 SASI_Mm01_00281892 predicted 1326
5 SASI_Mm01_00281893 predicted 347
6 SASI_Mm01_00281894 predicted 896
7 SASI_Mm01_00281895 predicted 1284
8 SASI_Mm01_00281896 predicted 1381
9 SASI_Mm01_00281897 predicted 592
10 SASI_Mm01_00281898 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203136 predicted 410
2 SASI_Mm01_00203137 predicted 243
3 SASI_Mm01_00203138 predicted 236
4 SASI_Mm01_00203139 predicted 987
5 SASI_Mm01_00203140 predicted 1460
6 SASI_Mm01_00203141 predicted 2018
7 SASI_Mm01_00203142 predicted 1857
8 SASI_Mm01_00203143 predicted 1106
9 SASI_Mm01_00203144 predicted 2029
10 SASI_Mm01_00203145 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153350
VALIDATED
FBXL16 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 16
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-632s21c1
Sequence:CCGGCAAGGAGCTCTACAACGTGCTCTCGAGAGCACGTTGTAGAGCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-945s21c1
Sequence:CCGGAGCGTGAGTGACTGCATCAACCTCGAGGTTGATGCAGTCACTCACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-659s21c1
Sequence:CCGGTGGCGAGAAGGAGTTCGTGAACTCGAGTTCACGAACTCCTTCTCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-509s21c1
Sequence:CCGGCAATGGGCTCTTCTGGTATTTCTCGAGAAATACCAGAAGAGCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153350.2-737s1c1
Sequence:CCGGCCTGGACATCTGTGAGTTCATCTCGAGATGAACTCACAGATGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153350.2-3032s1c1
Sequence:CCGGGCTGTTGAATCAGAAACAGATCTCGAGATCTGTTTCTGATTCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-746s1c1
Sequence:CCGGCTGTGAGTTCATTGACAACTACTCGAGTAGTTGTCAATGAACTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-833s1c1
Sequence:CCGGCGAGGTTATGCTTGAACAGATCTCGAGATCTGTTCAAGCATAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153350.2-3171s1c1
Sequence:CCGGGCTGTCCATTTGCCCAAAGTACTCGAGTACTTTGGGCAAATGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153350.2-1337s1c1
Sequence:CCGGGCTCGACAGGTGTGTACGCATCTCGAGATGCGTACACACCTGTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-248s1c1
Sequence:CCGGGCCTCGAAACGGTCTGGTGAACTCGAGTTCACCAGACCGTTTCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153350
VALIDATED
FBXL16 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 16
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-632s21c1
Sequence:CCGGCAAGGAGCTCTACAACGTGCTCTCGAGAGCACGTTGTAGAGCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-945s21c1
Sequence:CCGGAGCGTGAGTGACTGCATCAACCTCGAGGTTGATGCAGTCACTCACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-659s21c1
Sequence:CCGGTGGCGAGAAGGAGTTCGTGAACTCGAGTTCACGAACTCCTTCTCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-509s21c1
Sequence:CCGGCAATGGGCTCTTCTGGTATTTCTCGAGAAATACCAGAAGAGCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153350.2-737s1c1
Sequence:CCGGCCTGGACATCTGTGAGTTCATCTCGAGATGAACTCACAGATGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153350.2-3032s1c1
Sequence:CCGGGCTGTTGAATCAGAAACAGATCTCGAGATCTGTTTCTGATTCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-746s1c1
Sequence:CCGGCTGTGAGTTCATTGACAACTACTCGAGTAGTTGTCAATGAACTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-833s1c1
Sequence:CCGGCGAGGTTATGCTTGAACAGATCTCGAGATCTGTTCAAGCATAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153350.2-3171s1c1
Sequence:CCGGGCTGTCCATTTGCCCAAAGTACTCGAGTACTTTGGGCAAATGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153350.2-1337s1c1
Sequence:CCGGGCTCGACAGGTGTGTACGCATCTCGAGATGCGTACACACCTGTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-248s1c1
Sequence:CCGGGCCTCGAAACGGTCTGGTGAACTCGAGTTCACCAGACCGTTTCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153350
VALIDATED
FBXL16 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 16
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-632s21c1
Sequence:CCGGCAAGGAGCTCTACAACGTGCTCTCGAGAGCACGTTGTAGAGCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-945s21c1
Sequence:CCGGAGCGTGAGTGACTGCATCAACCTCGAGGTTGATGCAGTCACTCACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-659s21c1
Sequence:CCGGTGGCGAGAAGGAGTTCGTGAACTCGAGTTCACGAACTCCTTCTCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153350.2-509s21c1
Sequence:CCGGCAATGGGCTCTTCTGGTATTTCTCGAGAAATACCAGAAGAGCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153350.2-737s1c1
Sequence:CCGGCCTGGACATCTGTGAGTTCATCTCGAGATGAACTCACAGATGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122038    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153350.2-3032s1c1
Sequence:CCGGGCTGTTGAATCAGAAACAGATCTCGAGATCTGTTTCTGATTCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-746s1c1
Sequence:CCGGCTGTGAGTTCATTGACAACTACTCGAGTAGTTGTCAATGAACTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-833s1c1
Sequence:CCGGCGAGGTTATGCTTGAACAGATCTCGAGATCTGTTCAAGCATAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153350.2-3171s1c1
Sequence:CCGGGCTGTCCATTTGCCCAAAGTACTCGAGTACTTTGGGCAAATGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153350.2-1337s1c1
Sequence:CCGGGCTCGACAGGTGTGTACGCATCTCGAGATGCGTACACACCTGTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153350.2-248s1c1
Sequence:CCGGGCCTCGAAACGGTCTGGTGAACTCGAGTTCACCAGACCGTTTCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128530
FBXL16 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128530.6-2596s1c1
Sequence:CCGGCCTGGCATATAGGTGACAATACTCGAGTATTGTCACCTATATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-347s1c1
Sequence:CCGGGCATGTGAGAAGTGCATACTACTCGAGTAGTATGCACTTCTCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-547s1c1
Sequence:CCGGCGACTTAGACATCTGCGAGTTCTCGAGAACTCGCAGATGTCTAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-1264s1c1
Sequence:CCGGGCACCTCTTAGCCATGAGAAACTCGAGTTTCTCATGGCTAAGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-561s1c1
Sequence:CCGGGCGAGTTCATCGACAACTATTCTCGAGAATAGTTGTCGATGAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128530
FBXL16 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128530.6-2596s1c1
Sequence:CCGGCCTGGCATATAGGTGACAATACTCGAGTATTGTCACCTATATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-347s1c1
Sequence:CCGGGCATGTGAGAAGTGCATACTACTCGAGTAGTATGCACTTCTCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-547s1c1
Sequence:CCGGCGACTTAGACATCTGCGAGTTCTCGAGAACTCGCAGATGTCTAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-1264s1c1
Sequence:CCGGGCACCTCTTAGCCATGAGAAACTCGAGTTTCTCATGGCTAAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-561s1c1
Sequence:CCGGGCGAGTTCATCGACAACTATTCTCGAGAATAGTTGTCGATGAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128530
FBXL16 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128530.6-2596s1c1
Sequence:CCGGCCTGGCATATAGGTGACAATACTCGAGTATTGTCACCTATATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-347s1c1
Sequence:CCGGGCATGTGAGAAGTGCATACTACTCGAGTAGTATGCACTTCTCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-547s1c1
Sequence:CCGGCGACTTAGACATCTGCGAGTTCTCGAGAACTCGCAGATGTCTAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-1264s1c1
Sequence:CCGGGCACCTCTTAGCCATGAGAAACTCGAGTTTCTCATGGCTAAGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128530.6-561s1c1
Sequence:CCGGGCGAGTTCATCGACAACTATTCTCGAGAATAGTTGTCGATGAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)