EMAIL THIS PAGE TO A FRIEND

FBXL22

F-box and leucine-rich repeat protein 22

47 Gene Product Result for
Synonyms: Fbl22
UniProtKB ID: Q6P050
Gene ID:
Human(283807) Summary: This gene encodes a member of the F-box protein family. This F-box protein interacts with S-phase kinase-associated protein 1A and cullin in order to form SCF complexes which function as ubiquitin ligases.[provided by RefSeq, Sep 2010]
Mouse(74165) F-box and leucine-rich repeat protein 22
Rat(363083) F-box and leucine-rich repeat protein 22
naked mole-rat(101708466) F-box and leucine-rich repeat protein 22
sheep(101123561) F-box and leucine-rich repeat protein 22
Zebrafish(503591) F-box and leucine-rich repeat protein 22
cow(513821) F-box and leucine-rich repeat protein 22
domestic cat(101097981) F-box and leucine-rich repeat protein 22
dog(610651) F-box and leucine-rich repeat protein 22
chicken(101749169) F-box and leucine-rich repeat protein 22
chicken(101669034) F-box and leucine-rich repeat protein 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041591 MISSION® esiRNA esiRNA human FBXL22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203373 Rosetta Predictions human pricing
NM_001108769 Rosetta Predictions rat pricing
NM_175206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148202 predicted 234
2 SASI_Hs01_00148203 predicted 594
3 SASI_Hs01_00148204 predicted 408
4 SASI_Hs01_00148205 predicted 305
5 SASI_Hs01_00148206 predicted 298
6 SASI_Hs01_00148207 predicted 403
7 SASI_Hs01_00148208 predicted 236
8 SASI_Hs01_00148209 predicted 298
9 SASI_Hs01_00148210 predicted 301
10 SASI_Hs01_00148211 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241895 predicted 977
2 SASI_Rn02_00241896 predicted 346
3 SASI_Rn02_00241897 predicted 1134
4 SASI_Rn02_00241898 predicted 974
5 SASI_Rn02_00241899 predicted 1119
6 SASI_Rn02_00241900 predicted 1016
7 SASI_Rn02_00241901 predicted 735
8 SASI_Rn02_00241902 predicted 761
9 SASI_Rn02_00241903 predicted 844
10 SASI_Rn02_00241904 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076292 predicted 1038
2 SASI_Mm01_00076293 predicted 1065
3 SASI_Mm01_00076294 predicted 970
4 SASI_Mm01_00076295 predicted 962
5 SASI_Mm01_00076296 predicted 917
6 SASI_Mm01_00076297 predicted 215
7 SASI_Mm01_00076298 predicted 1227
8 SASI_Mm01_00076299 predicted 157
9 SASI_Mm01_00076300 predicted 445
10 SASI_Mm01_00076301 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203373
FBXL22 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1155s21c1
Sequence:CCGGAGCTGCGACAAAGCCCTTTACCTCGAGGTAAAGGGCTTTGTCGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1010s21c1
Sequence:CCGCAGTCACTGATGTGTCACATTTCTCGAGAAATGTGACACATCAGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-974s21c1
Sequence:CCGGACAAGCCTAGGCTTCCAATTTCTCGAGAAATTGGAAGCCTAGGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-53s1c1
Sequence:CCGGCCTCTTCTCCTTCCTAGACAACTCGAGTTGTCTAGGAAGGAGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-779s1c1
Sequence:CCGGGAATGCTTACATAAACTGCATCTCGAGATGCAGTTTATGTAAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-770s1c1
Sequence:CCGGCCAATTGTTGAATGCTTACATCTCGAGATGTAAGCATTCAACAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-314s1c1
Sequence:CCGGCCTGGTCAATGATTTCCTCCTCTCGAGAGGAGGAAATCATTGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-1187s1c1
Sequence:CCGGCAGGTGTTTCTTCTGTGTGAACTCGAGTTCACACAGAAGAAACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-949s1c1
Sequence:CCGGCCTGTTGGATTTGCTGGACATCTCGAGATGTCCAGCAAATCCAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-56s1c1
Sequence:CCGGCTTCTCCTTCCTAGACAAGGACTCGAGTCCTTGTCTAGGAAGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203373
FBXL22 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1155s21c1
Sequence:CCGGAGCTGCGACAAAGCCCTTTACCTCGAGGTAAAGGGCTTTGTCGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1010s21c1
Sequence:CCGCAGTCACTGATGTGTCACATTTCTCGAGAAATGTGACACATCAGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-974s21c1
Sequence:CCGGACAAGCCTAGGCTTCCAATTTCTCGAGAAATTGGAAGCCTAGGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-53s1c1
Sequence:CCGGCCTCTTCTCCTTCCTAGACAACTCGAGTTGTCTAGGAAGGAGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-779s1c1
Sequence:CCGGGAATGCTTACATAAACTGCATCTCGAGATGCAGTTTATGTAAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-770s1c1
Sequence:CCGGCCAATTGTTGAATGCTTACATCTCGAGATGTAAGCATTCAACAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-314s1c1
Sequence:CCGGCCTGGTCAATGATTTCCTCCTCTCGAGAGGAGGAAATCATTGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-1187s1c1
Sequence:CCGGCAGGTGTTTCTTCTGTGTGAACTCGAGTTCACACAGAAGAAACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-949s1c1
Sequence:CCGGCCTGTTGGATTTGCTGGACATCTCGAGATGTCCAGCAAATCCAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-56s1c1
Sequence:CCGGCTTCTCCTTCCTAGACAAGGACTCGAGTCCTTGTCTAGGAAGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203373
FBXL22 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1155s21c1
Sequence:CCGGAGCTGCGACAAAGCCCTTTACCTCGAGGTAAAGGGCTTTGTCGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-1010s21c1
Sequence:CCGCAGTCACTGATGTGTCACATTTCTCGAGAAATGTGACACATCAGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203373.1-974s21c1
Sequence:CCGGACAAGCCTAGGCTTCCAATTTCTCGAGAAATTGGAAGCCTAGGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-53s1c1
Sequence:CCGGCCTCTTCTCCTTCCTAGACAACTCGAGTTGTCTAGGAAGGAGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-779s1c1
Sequence:CCGGGAATGCTTACATAAACTGCATCTCGAGATGCAGTTTATGTAAGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-770s1c1
Sequence:CCGGCCAATTGTTGAATGCTTACATCTCGAGATGTAAGCATTCAACAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-314s1c1
Sequence:CCGGCCTGGTCAATGATTTCCTCCTCTCGAGAGGAGGAAATCATTGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-1187s1c1
Sequence:CCGGCAGGTGTTTCTTCTGTGTGAACTCGAGTTCACACAGAAGAAACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203373.1-949s1c1
Sequence:CCGGCCTGTTGGATTTGCTGGACATCTCGAGATGTCCAGCAAATCCAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203373.1-56s1c1
Sequence:CCGGCTTCTCCTTCCTAGACAAGGACTCGAGTCCTTGTCTAGGAAGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175206
FBXL22 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175206.2-1947s1c1
Sequence:CCGGGCCTGGTGTAATGCCTTCTAACTCGAGTTAGAAGGCATTACACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-188s1c1
Sequence:CCGGCAAGAAAGACAACTTCCGGCTCTCGAGAGCCGGAAGTTGTCTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-179s1c1
Sequence:CCGGCGCAGAGCTCAAGAAAGACAACTCGAGTTGTCTTTCTTGAGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-314s1c1
Sequence:CCGGCCAGCACGAGAGCCTGGTTAACTCGAGTTAACCAGGCTCTCGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-320s1c1
Sequence:CCGGCGAGAGCCTGGTTAATGATTTCTCGAGAAATCATTAACCAGGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175206
FBXL22 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175206.2-1947s1c1
Sequence:CCGGGCCTGGTGTAATGCCTTCTAACTCGAGTTAGAAGGCATTACACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-188s1c1
Sequence:CCGGCAAGAAAGACAACTTCCGGCTCTCGAGAGCCGGAAGTTGTCTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-179s1c1
Sequence:CCGGCGCAGAGCTCAAGAAAGACAACTCGAGTTGTCTTTCTTGAGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-314s1c1
Sequence:CCGGCCAGCACGAGAGCCTGGTTAACTCGAGTTAACCAGGCTCTCGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-320s1c1
Sequence:CCGGCGAGAGCCTGGTTAATGATTTCTCGAGAAATCATTAACCAGGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175206
FBXL22 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175206.2-1947s1c1
Sequence:CCGGGCCTGGTGTAATGCCTTCTAACTCGAGTTAGAAGGCATTACACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-188s1c1
Sequence:CCGGCAAGAAAGACAACTTCCGGCTCTCGAGAGCCGGAAGTTGTCTTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-179s1c1
Sequence:CCGGCGCAGAGCTCAAGAAAGACAACTCGAGTTGTCTTTCTTGAGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-314s1c1
Sequence:CCGGCCAGCACGAGAGCCTGGTTAACTCGAGTTAACCAGGCTCTCGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175206.2-320s1c1
Sequence:CCGGCGAGAGCCTGGTTAATGATTTCTCGAGAAATCATTAACCAGGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)