EMAIL THIS PAGE TO A FRIEND

FBXL4

F-box and leucine-rich repeat protein 4

93 Gene Product Result for
Synonyms: FBL4 FBL5
UniProtKB ID: Q9UKA2, E1P530, O95919, Q5BJH0, Q9UJU0
Gene ID:
Human(26235) Summary: This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(269514) F-box and leucine-rich repeat protein 4
Rat(313101) F-box and leucine-rich repeat protein 4
Zebrafish(492349) F-box and leucine-rich repeat protein 4
fruit fly(32378) F box and leucine-rich-repeat gene 4
cow(535452) F-box and leucine-rich repeat protein 4
Horse(100066051) F-box and leucine-rich repeat protein 4
domestic cat(101083680) F-box and leucine-rich repeat protein 4
dog(481932) F-box and leucine-rich repeat protein 4
chicken(421798) F-box and leucine-rich repeat protein 4
domestic guinea pig(100723716) F-box and leucine-rich repeat protein 4
naked mole-rat(101717262) F-box and leucine-rich repeat protein 4
sheep(101104499) F-box and leucine-rich repeat protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037821 MISSION® esiRNA esiRNA human FBXL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012160 Rosetta Predictions human pricing
NM_001107919 Rosetta Predictions rat pricing
NM_172988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343747 predicted 874
2 SASI_Hs02_00343748 predicted 1205
3 SASI_Hs02_00343749 predicted 2012
4 SASI_Hs01_00174109 predicted 2006
5 SASI_Hs02_00343750 predicted 2032
6 SASI_Hs01_00174110 predicted 723
7 SASI_Hs01_00174111 predicted 920
8 SASI_Hs01_00174114 predicted 640
9 SASI_Hs02_00343751 predicted 995
10 SASI_Hs01_00174116 predicted 1419
11 SASI_Hs01_00174112 predicted 1228
12 SASI_Hs01_00174113 predicted 564
13 SASI_Hs01_00174115 predicted 1542
14 SASI_Hs01_00174117 predicted 2005
15 SASI_Hs01_00174118 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233575 predicted 385
2 SASI_Rn02_00233576 predicted 523
3 SASI_Rn02_00233577 predicted 907
4 SASI_Rn02_00233578 predicted 584
5 SASI_Rn02_00233579 predicted 1247
6 SASI_Rn02_00233580 predicted 864
7 SASI_Rn02_00233581 predicted 597
8 SASI_Rn02_00233582 predicted 671
9 SASI_Rn02_00233583 predicted 695
10 SASI_Rn02_00233584 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094122 predicted 1382
2 SASI_Mm01_00094123 predicted 891
3 SASI_Mm02_00345027 predicted 813
4 SASI_Mm01_00094124 predicted 1947
5 SASI_Mm01_00094126 predicted 664
6 SASI_Mm02_00345028 predicted 914
7 SASI_Mm01_00094127 predicted 1230
8 SASI_Mm02_00345029 predicted 377
9 SASI_Mm01_00094129 predicted 1505
10 SASI_Mm01_00094130 predicted 1962
11 SASI_Mm01_00094125 predicted 466
12 SASI_Mm01_00094128 predicted 1482
13 SASI_Mm01_00094131 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012160
VALIDATED
FBXL4 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012160.3-2543s1c1
Sequence:CCGGGCAATAAAGTATCGTGGCATTCTCGAGAATGCCACGATACTTTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-726s1c1
Sequence:CCGGGCCAGGACTATGTGGAACTTACTCGAGTAAGTTCCACATAGTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1482s1c1
Sequence:CCGGCCGAATTAGTACGCCTTGAATCTCGAGATTCAAGGCGTACTAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012160.3-1512s1c1
Sequence:CCGGGCCACTTTCTTAATGAAACTTCTCGAGAAGTTTCATTAAGAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1483s1c1
Sequence:CCGGCGAATTAGTACGCCTTGAATTCTCGAGAATTCAAGGCGTACTAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012160
VALIDATED
FBXL4 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012160.3-2543s1c1
Sequence:CCGGGCAATAAAGTATCGTGGCATTCTCGAGAATGCCACGATACTTTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-726s1c1
Sequence:CCGGGCCAGGACTATGTGGAACTTACTCGAGTAAGTTCCACATAGTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1482s1c1
Sequence:CCGGCCGAATTAGTACGCCTTGAATCTCGAGATTCAAGGCGTACTAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012160.3-1512s1c1
Sequence:CCGGGCCACTTTCTTAATGAAACTTCTCGAGAAGTTTCATTAAGAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1483s1c1
Sequence:CCGGCGAATTAGTACGCCTTGAATTCTCGAGAATTCAAGGCGTACTAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012160
VALIDATED
FBXL4 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012160.3-2543s1c1
Sequence:CCGGGCAATAAAGTATCGTGGCATTCTCGAGAATGCCACGATACTTTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-726s1c1
Sequence:CCGGGCCAGGACTATGTGGAACTTACTCGAGTAAGTTCCACATAGTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1482s1c1
Sequence:CCGGCCGAATTAGTACGCCTTGAATCTCGAGATTCAAGGCGTACTAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012160.3-1512s1c1
Sequence:CCGGGCCACTTTCTTAATGAAACTTCTCGAGAAGTTTCATTAAGAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012160.3-1483s1c1
Sequence:CCGGCGAATTAGTACGCCTTGAATTCTCGAGAATTCAAGGCGTACTAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172988
VALIDATED
FBXL4 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-2218s1c1
Sequence:CCGGGCTCTTCTGTTTGTTTGGTTTCTCGAGAAACCAAACAAACAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1961s1c1
Sequence:CCGGGCATCTAATTGTACCAGATTACTCGAGTAATCTGGTACAATTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-863s1c1
Sequence:CCGGCGTCAGTTTAAACCTTGTATTCTCGAGAATACAAGGTTTAAACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1498s1c1
Sequence:CCGGCCCAAATCTACAAGACTTAAACTCGAGTTTAAGTCTTGTAGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1497s1c1
Sequence:CCGGGCCCAAATCTACAAGACTTAACTCGAGTTAAGTCTTGTAGATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172988
VALIDATED
FBXL4 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-2218s1c1
Sequence:CCGGGCTCTTCTGTTTGTTTGGTTTCTCGAGAAACCAAACAAACAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1961s1c1
Sequence:CCGGGCATCTAATTGTACCAGATTACTCGAGTAATCTGGTACAATTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-863s1c1
Sequence:CCGGCGTCAGTTTAAACCTTGTATTCTCGAGAATACAAGGTTTAAACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1498s1c1
Sequence:CCGGCCCAAATCTACAAGACTTAAACTCGAGTTTAAGTCTTGTAGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1497s1c1
Sequence:CCGGGCCCAAATCTACAAGACTTAACTCGAGTTAAGTCTTGTAGATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172988
VALIDATED
FBXL4 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-2218s1c1
Sequence:CCGGGCTCTTCTGTTTGTTTGGTTTCTCGAGAAACCAAACAAACAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1961s1c1
Sequence:CCGGGCATCTAATTGTACCAGATTACTCGAGTAATCTGGTACAATTAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-863s1c1
Sequence:CCGGCGTCAGTTTAAACCTTGTATTCTCGAGAATACAAGGTTTAAACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1498s1c1
Sequence:CCGGCCCAAATCTACAAGACTTAAACTCGAGTTTAAGTCTTGTAGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172988.1-1497s1c1
Sequence:CCGGGCCCAAATCTACAAGACTTAACTCGAGTTAAGTCTTGTAGATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)