EMAIL THIS PAGE TO A FRIEND

FBXO16

F-box protein 16

96 Gene Product Result for
Synonyms: FBX16
UniProtKB ID: Q8IX29, Q3T1B2, Q3T1B3, Q3T1B4
Gene ID:
Human(157574) Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(50759) F-box protein 16
Rat(305970) F-box protein 16
sheep(101115941) F-box protein 16
naked mole-rat(101726144) F-box protein 16
Zebrafish(550375) F-box protein 16
chicken(771262) F-box protein 16
cow(768246) F-box protein 16
domestic cat(101081292) F-box protein 16
dog(608213) F-box protein 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172366 Rosetta Predictions human pricing
NM_001013132 Rosetta Predictions rat pricing
NM_015795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090277 predicted 317
2 SASI_Hs01_00090278 predicted 766
3 SASI_Hs01_00090279 predicted 760
4 SASI_Hs01_00090280 predicted 369
5 SASI_Hs01_00090281 predicted 544
6 SASI_Hs01_00090282 predicted 478
7 SASI_Hs02_00368017 predicted 906
8 SASI_Hs01_00090284 predicted 551
9 SASI_Hs01_00090285 predicted 925
10 SASI_Hs02_00368018 predicted 644
11 SASI_Hs01_00090283 predicted 557
12 SASI_Hs01_00090286 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037638 predicted 853
2 SASI_Rn01_00037640 predicted 878
3 SASI_Rn01_00037641 predicted 217
4 SASI_Rn01_00037642 predicted 212
5 SASI_Rn01_00037644 predicted 316
6 SASI_Rn01_00037646 predicted 255
7 SASI_Rn01_00037647 predicted 821
8 SASI_Rn02_00200844 predicted 367
9 SASI_Rn02_00200845 predicted 404
10 SASI_Rn02_00200846 predicted 824
11 SASI_Rn01_00037639 predicted 308
12 SASI_Rn01_00037643 predicted 982
13 SASI_Rn01_00037645 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195542 predicted 402
2 SASI_Mm01_00195543 predicted 943
3 SASI_Mm02_00323156 predicted 618
4 SASI_Mm01_00195544 predicted 787
5 SASI_Mm01_00195546 predicted 272
6 SASI_Mm01_00195547 predicted 318
7 SASI_Mm01_00195548 predicted 831
8 SASI_Mm01_00195549 predicted 783
9 SASI_Mm01_00195550 predicted 789
10 SASI_Mm01_00195551 predicted 395
11 SASI_Mm01_00195545 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172366
VALIDATED
FBXO16 MISSION shRNA Bacterial Glycerol Stock
F-box protein 16
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-217s21c1
Sequence:CCGGCCCTGCTTGGCAAATGGTTTGCTCGAGCAAACCATTTGCCAAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1119s21c1
Sequence:CCGGAGGTTCCAGAGCCAAAGTGGACTCGAGTCCACTTTGGCTCTGGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-171s21c1
Sequence:CCGGCTAAACCATCAGCTATTGAATCTCGAGATTCAATAGCTGATGGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-368s21c1
Sequence:CCGGCAAGCTTCCAAGGGTGTTATCCTCGAGGATAACACCCTTGGAAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-626s21c1
Sequence:CCGGTGTAATCGCTGACGTTCAACTCTCGAGAGTTGAACGTCAGCGATTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1108s21c1
Sequence:CCGGATGACTCATCCAGGTTCCAGACTCGAGTCTGGAACCTGGATGAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-562s21c1
Sequence:CCGGACTATATTCAAATGGTGAAAGCTCGAGCTTTCACCATTTGAATATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-875s1c1
Sequence:CCGGCCGACAGTCACATGATAAGAACTCGAGTTCTTATCATGTGACTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172366.2-1061s1c1
Sequence:CCGGGCTGAAATTCTCATGCAGCATCTCGAGATGCTGCATGAGAATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172366.2-182s1c1
Sequence:CCGGGCTATTGAATGACCGGGTATTCTCGAGAATACCCGGTCATTCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-757s1c1
Sequence:CCGGGATCTTCTGATAAGCACCCAACTCGAGTTGGGTGCTTATCAGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-548s1c1
Sequence:CCGGGATCTGGAAGAAGCACTATATCTCGAGATATAGTGCTTCTTCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172366.2-1138s1c1
Sequence:CCGGGACTGAACATGGAAAGACTTTCTCGAGAAAGTCTTTCCATGTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-611s1c1
Sequence:CCGGCCCAAAGGATGGATTTGTAATCTCGAGATTACAAATCCATCCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-638s1c1
Sequence:CCGGCGTTCAACTAGTTACAAGCAACTCGAGTTGCTTGTAACTAGTTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172366
VALIDATED
FBXO16 MISSION shRNA shRNA Plasmid DNA
F-box protein 16
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-217s21c1
Sequence:CCGGCCCTGCTTGGCAAATGGTTTGCTCGAGCAAACCATTTGCCAAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1119s21c1
Sequence:CCGGAGGTTCCAGAGCCAAAGTGGACTCGAGTCCACTTTGGCTCTGGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-171s21c1
Sequence:CCGGCTAAACCATCAGCTATTGAATCTCGAGATTCAATAGCTGATGGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-368s21c1
Sequence:CCGGCAAGCTTCCAAGGGTGTTATCCTCGAGGATAACACCCTTGGAAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-626s21c1
Sequence:CCGGTGTAATCGCTGACGTTCAACTCTCGAGAGTTGAACGTCAGCGATTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1108s21c1
Sequence:CCGGATGACTCATCCAGGTTCCAGACTCGAGTCTGGAACCTGGATGAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-562s21c1
Sequence:CCGGACTATATTCAAATGGTGAAAGCTCGAGCTTTCACCATTTGAATATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-875s1c1
Sequence:CCGGCCGACAGTCACATGATAAGAACTCGAGTTCTTATCATGTGACTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172366.2-1061s1c1
Sequence:CCGGGCTGAAATTCTCATGCAGCATCTCGAGATGCTGCATGAGAATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172366.2-182s1c1
Sequence:CCGGGCTATTGAATGACCGGGTATTCTCGAGAATACCCGGTCATTCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-757s1c1
Sequence:CCGGGATCTTCTGATAAGCACCCAACTCGAGTTGGGTGCTTATCAGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-548s1c1
Sequence:CCGGGATCTGGAAGAAGCACTATATCTCGAGATATAGTGCTTCTTCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172366.2-1138s1c1
Sequence:CCGGGACTGAACATGGAAAGACTTTCTCGAGAAAGTCTTTCCATGTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-611s1c1
Sequence:CCGGCCCAAAGGATGGATTTGTAATCTCGAGATTACAAATCCATCCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-638s1c1
Sequence:CCGGCGTTCAACTAGTTACAAGCAACTCGAGTTGCTTGTAACTAGTTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172366
VALIDATED
FBXO16 MISSION shRNA Lentiviral Transduction Particles
F-box protein 16
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-217s21c1
Sequence:CCGGCCCTGCTTGGCAAATGGTTTGCTCGAGCAAACCATTTGCCAAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1119s21c1
Sequence:CCGGAGGTTCCAGAGCCAAAGTGGACTCGAGTCCACTTTGGCTCTGGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-171s21c1
Sequence:CCGGCTAAACCATCAGCTATTGAATCTCGAGATTCAATAGCTGATGGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-368s21c1
Sequence:CCGGCAAGCTTCCAAGGGTGTTATCCTCGAGGATAACACCCTTGGAAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-626s21c1
Sequence:CCGGTGTAATCGCTGACGTTCAACTCTCGAGAGTTGAACGTCAGCGATTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172366.2-1108s21c1
Sequence:CCGGATGACTCATCCAGGTTCCAGACTCGAGTCTGGAACCTGGATGAGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172366.2-562s21c1
Sequence:CCGGACTATATTCAAATGGTGAAAGCTCGAGCTTTCACCATTTGAATATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-875s1c1
Sequence:CCGGCCGACAGTCACATGATAAGAACTCGAGTTCTTATCATGTGACTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172366.2-1061s1c1
Sequence:CCGGGCTGAAATTCTCATGCAGCATCTCGAGATGCTGCATGAGAATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172366.2-182s1c1
Sequence:CCGGGCTATTGAATGACCGGGTATTCTCGAGAATACCCGGTCATTCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-757s1c1
Sequence:CCGGGATCTTCTGATAAGCACCCAACTCGAGTTGGGTGCTTATCAGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172366.2-548s1c1
Sequence:CCGGGATCTGGAAGAAGCACTATATCTCGAGATATAGTGCTTCTTCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172366.2-1138s1c1
Sequence:CCGGGACTGAACATGGAAAGACTTTCTCGAGAAAGTCTTTCCATGTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-611s1c1
Sequence:CCGGCCCAAAGGATGGATTTGTAATCTCGAGATTACAAATCCATCCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172366.2-638s1c1
Sequence:CCGGCGTTCAACTAGTTACAAGCAACTCGAGTTGCTTGTAACTAGTTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015795
FBXO16 MISSION shRNA Bacterial Glycerol Stock
F-box protein 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-797s1c1
Sequence:CCGGCCACTGACATCATCCGCTTTACTCGAGTAAAGCGGATGATGTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-798s1c1
Sequence:CCGGCACTGACATCATCCGCTTTAACTCGAGTTAAAGCGGATGATGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-389s1c1
Sequence:CCGGCCAAGCTTCCAAGGGTGTTATCTCGAGATAACACCCTTGGAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-215s1c1
Sequence:CCGGACCAGGTATTTGAAGAACGAACTCGAGTTCGTTCTTCAAATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-652s1c1
Sequence:CCGGACTGCCGATGTTCAGCCAATTCTCGAGAATTGGCTGAACATCGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015795
FBXO16 MISSION shRNA shRNA Plasmid DNA
F-box protein 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-797s1c1
Sequence:CCGGCCACTGACATCATCCGCTTTACTCGAGTAAAGCGGATGATGTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-798s1c1
Sequence:CCGGCACTGACATCATCCGCTTTAACTCGAGTTAAAGCGGATGATGTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-389s1c1
Sequence:CCGGCCAAGCTTCCAAGGGTGTTATCTCGAGATAACACCCTTGGAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-215s1c1
Sequence:CCGGACCAGGTATTTGAAGAACGAACTCGAGTTCGTTCTTCAAATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-652s1c1
Sequence:CCGGACTGCCGATGTTCAGCCAATTCTCGAGAATTGGCTGAACATCGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015795
FBXO16 MISSION shRNA Lentiviral Transduction Particles
F-box protein 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-797s1c1
Sequence:CCGGCCACTGACATCATCCGCTTTACTCGAGTAAAGCGGATGATGTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-798s1c1
Sequence:CCGGCACTGACATCATCCGCTTTAACTCGAGTTAAAGCGGATGATGTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-389s1c1
Sequence:CCGGCCAAGCTTCCAAGGGTGTTATCTCGAGATAACACCCTTGGAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-215s1c1
Sequence:CCGGACCAGGTATTTGAAGAACGAACTCGAGTTCGTTCTTCAAATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015795.1-652s1c1
Sequence:CCGGACTGCCGATGTTCAGCCAATTCTCGAGAATTGGCTGAACATCGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)