EMAIL THIS PAGE TO A FRIEND

FBXO40

F-box protein 40

111 Gene Product Result for
Synonyms: FBX40
UniProtKB ID: Q9UH90, B2RAX7, Q32M70, Q9ULM5
Gene ID:
Human(51725) Summary: Members of the F-box protein family, such as FBXO40, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(207215) F-box protein 40
Rat(363790) F-box protein 40
sheep(101109929) F-box protein 40
naked mole-rat(101723744) F-box protein 40
chicken(426341) F-box protein 40
dog(488004) F-box protein 40
domestic cat(101089639) F-box protein 40
Horse(100070778) F-box protein 40
cow(613597) F-box protein 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209391 MISSION® esiRNA esiRNA targeting mouse Fbxo40 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016298 Rosetta Predictions human pricing
XM_001070422 Rosetta Predictions rat pricing
XM_344023 Rosetta Predictions rat pricing
NM_001037321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243642 predicted 2203
2 SASI_Hs02_00349219 predicted 1320
3 SASI_Hs01_00243645 predicted 1298
4 SASI_Hs01_00243646 predicted 523
5 SASI_Hs01_00243648 predicted 1678
6 SASI_Hs02_00349220 predicted 1874
7 SASI_Hs01_00243649 predicted 1115
8 SASI_Hs02_00349221 predicted 1140
9 SASI_Hs01_00243650 predicted 1496
10 SASI_Hs01_00243651 predicted 1124
11 SASI_Hs01_00243643 predicted 548
12 SASI_Hs01_00243644 predicted 1372
13 SASI_Hs01_00243647 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331595 predicted 1885
2 SASI_Rn02_00331596 predicted 1685
3 SASI_Rn02_00331597 predicted 1430
4 SASI_Rn02_00331598 predicted 695
5 SASI_Rn02_00331599 predicted 1950
6 SASI_Rn02_00331600 predicted 1005
7 SASI_Rn02_00331601 predicted 1763
8 SASI_Rn02_00331602 predicted 1945
9 SASI_Rn02_00331603 predicted 1160
10 SASI_Rn02_00331604 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396704 predicted 926
2 SASI_Rn02_00396705 predicted 1007
3 SASI_Rn02_00396706 predicted 871
4 SASI_Rn02_00396707 predicted 973
5 SASI_Rn02_00396708 predicted 689
6 SASI_Rn02_00396709 predicted 615
7 SASI_Rn02_00396710 predicted 1037
8 SASI_Rn02_00396711 predicted 947
9 SASI_Rn02_00396712 predicted 2195
10 SASI_Rn02_00396713 predicted 2186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131517 predicted 1251
2 SASI_Mm01_00131518 predicted 2126
3 SASI_Mm01_00131519 predicted 1424
4 SASI_Mm01_00131520 predicted 852
5 SASI_Mm01_00131521 predicted 1398
6 SASI_Mm01_00131522 predicted 1776
7 SASI_Mm01_00131523 predicted 2194
8 SASI_Mm01_00131524 predicted 530
9 SASI_Mm01_00131525 predicted 1670
10 SASI_Mm02_00289304 predicted 671
11 SASI_Mm01_00131526 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016298
FBXO40 MISSION shRNA Bacterial Glycerol Stock
F-box protein 40
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-300s21c1
Sequence:CCGGCACCTCCTGCCTGGTAATAAGCTCGAGCTTATTACCAGGCAGGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016298.3-2664s21c1
Sequence:CCGGGTGATGAGAGAGCACGAAATTCTCGAGAATTTCGTGCTCTCTCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-1114s21c1
Sequence:CCGGGTGGATGCAAAGGACTATAACCTCGAGGTTATAGTCCTTTGCATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1616s1c1
Sequence:CCGGGTCATGTCTCAATGGCTGGTTCTCGAGAACCAGCCATTGAGACATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-849s1c1
Sequence:CCGGGACTCCGAGAAAGAACAGATTCTCGAGAATCTGTTCTTTCTCGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016298.1-2332s1c1
Sequence:CCGGCCTTCTGTAAACTGCCTATTTCTCGAGAAATAGGCAGTTTACAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1067s1c1
Sequence:CCGGGCTGATACACTTTGGTCAGATCTCGAGATCTGACCAAAGTGTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1395s1c1
Sequence:CCGGGCCACACAAACATACAACTTTCTCGAGAAAGTTGTATGTTTGTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016298
FBXO40 MISSION shRNA shRNA Plasmid DNA
F-box protein 40
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-300s21c1
Sequence:CCGGCACCTCCTGCCTGGTAATAAGCTCGAGCTTATTACCAGGCAGGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016298.3-2664s21c1
Sequence:CCGGGTGATGAGAGAGCACGAAATTCTCGAGAATTTCGTGCTCTCTCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-1114s21c1
Sequence:CCGGGTGGATGCAAAGGACTATAACCTCGAGGTTATAGTCCTTTGCATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1616s1c1
Sequence:CCGGGTCATGTCTCAATGGCTGGTTCTCGAGAACCAGCCATTGAGACATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-849s1c1
Sequence:CCGGGACTCCGAGAAAGAACAGATTCTCGAGAATCTGTTCTTTCTCGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016298.1-2332s1c1
Sequence:CCGGCCTTCTGTAAACTGCCTATTTCTCGAGAAATAGGCAGTTTACAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1067s1c1
Sequence:CCGGGCTGATACACTTTGGTCAGATCTCGAGATCTGACCAAAGTGTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1395s1c1
Sequence:CCGGGCCACACAAACATACAACTTTCTCGAGAAAGTTGTATGTTTGTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016298
FBXO40 MISSION shRNA Lentiviral Transduction Particles
F-box protein 40
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-300s21c1
Sequence:CCGGCACCTCCTGCCTGGTAATAAGCTCGAGCTTATTACCAGGCAGGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016298.3-2664s21c1
Sequence:CCGGGTGATGAGAGAGCACGAAATTCTCGAGAATTTCGTGCTCTCTCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016298.3-1114s21c1
Sequence:CCGGGTGGATGCAAAGGACTATAACCTCGAGGTTATAGTCCTTTGCATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1616s1c1
Sequence:CCGGGTCATGTCTCAATGGCTGGTTCTCGAGAACCAGCCATTGAGACATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-849s1c1
Sequence:CCGGGACTCCGAGAAAGAACAGATTCTCGAGAATCTGTTCTTTCTCGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016298.1-2332s1c1
Sequence:CCGGCCTTCTGTAAACTGCCTATTTCTCGAGAAATAGGCAGTTTACAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1067s1c1
Sequence:CCGGGCTGATACACTTTGGTCAGATCTCGAGATCTGACCAAAGTGTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016298.1-1395s1c1
Sequence:CCGGGCCACACAAACATACAACTTTCTCGAGAAAGTTGTATGTTTGTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037321
FBXO40 MISSION shRNA Bacterial Glycerol Stock
F-box protein 40
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1638s21c1
Sequence:CCGGGGAGCATCGATGGACTCTTTACTCGAGTAAAGAGTCCATCGATGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1291s21c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-2040s21c1
Sequence:CCGGCTCCGGAGCTGAGTGAGAAATCTCGAGATTTCTCACTCAGCTCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1815s21c1
Sequence:CCGGTTACGTTCACCTGCAACAAATCTCGAGATTTGTTGCAGGTGAACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-915s21c1
Sequence:CCGGATGCCAGGCTAGCACCAAATTCTCGAGAATTTGGTGCTAGCCTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-1291s1c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-922s1c1
Sequence:CCGGGCTAGCACCAAATTCTTGTTTCTCGAGAAACAAGAATTTGGTGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-715s1c1
Sequence:CCGGCCTTCACGAGAACATCATGAACTCGAGTTCATGATGTTCTCGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037321
FBXO40 MISSION shRNA shRNA Plasmid DNA
F-box protein 40
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1638s21c1
Sequence:CCGGGGAGCATCGATGGACTCTTTACTCGAGTAAAGAGTCCATCGATGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1291s21c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-2040s21c1
Sequence:CCGGCTCCGGAGCTGAGTGAGAAATCTCGAGATTTCTCACTCAGCTCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1815s21c1
Sequence:CCGGTTACGTTCACCTGCAACAAATCTCGAGATTTGTTGCAGGTGAACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-915s21c1
Sequence:CCGGATGCCAGGCTAGCACCAAATTCTCGAGAATTTGGTGCTAGCCTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-1291s1c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-922s1c1
Sequence:CCGGGCTAGCACCAAATTCTTGTTTCTCGAGAAACAAGAATTTGGTGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-715s1c1
Sequence:CCGGCCTTCACGAGAACATCATGAACTCGAGTTCATGATGTTCTCGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037321
FBXO40 MISSION shRNA Lentiviral Transduction Particles
F-box protein 40
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1638s21c1
Sequence:CCGGGGAGCATCGATGGACTCTTTACTCGAGTAAAGAGTCCATCGATGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1291s21c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-2040s21c1
Sequence:CCGGCTCCGGAGCTGAGTGAGAAATCTCGAGATTTCTCACTCAGCTCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-1815s21c1
Sequence:CCGGTTACGTTCACCTGCAACAAATCTCGAGATTTGTTGCAGGTGAACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037321.1-915s21c1
Sequence:CCGGATGCCAGGCTAGCACCAAATTCTCGAGAATTTGGTGCTAGCCTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-1291s1c1
Sequence:CCGGCGTGGATGCCAAAGACTATAACTCGAGTTATAGTCTTTGGCATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-922s1c1
Sequence:CCGGGCTAGCACCAAATTCTTGTTTCTCGAGAAACAAGAATTTGGTGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037321.1-715s1c1
Sequence:CCGGCCTTCACGAGAACATCATGAACTCGAGTTCATGATGTTCTCGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)