EMAIL THIS PAGE TO A FRIEND

FCER1G

Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide

49 Gene Product Result for
Synonyms: FCRG
UniProtKB ID: P30273, Q5VTW4
Gene ID:
Human(2207) Summary: The high affinity IgE receptor is a key molecule involved in allergic reactions. It is a tetramer composed of 1 alpha, 1 beta, and 2 gamma chains. The gamma chains are also subunits of other Fc receptors. [provided by RefSeq, Jul 2008]
Mouse(14127) Fc receptor, IgE, high affinity I, gamma polypeptide
Rat(25441) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
sheep(443204) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
naked mole-rat(101702022) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
domestic guinea pig(100713546) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Zebrafish(100101464) Fc receptor, IgE, high affinity I, gamma polypeptide
dog(403798) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Horse(100034137) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
cow(282226) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
domestic cat(101089236) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
chicken(100049618) Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004106 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004106 Rosetta Predictions human pricing
NM_001131001 Rosetta Predictions rat pricing
NM_010185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149036 predicted 349
2 SASI_Hs01_00149037 predicted 287
3 SASI_Hs01_00149038 predicted 334
4 SASI_Hs01_00149039 predicted 251
5 SASI_Hs01_00149043 predicted 353
6 SASI_Hs01_00149044 predicted 293
7 SASI_Hs02_00336926 predicted 254
8 SASI_Hs02_00336927 predicted 245
9 SASI_Hs02_00336928 predicted 213
10 SASI_Hs02_00336929 predicted 347
11 SASI_Hs01_00149035 predicted 299
12 SASI_Hs01_00149040 predicted 273
13 SASI_Hs01_00149041 predicted 271
14 SASI_Hs01_00149042 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256129 predicted 235
2 SASI_Rn02_00256130 predicted 233
3 SASI_Rn02_00256131 predicted 288
4 SASI_Rn02_00256132 predicted 349
5 SASI_Rn02_00256133 predicted 195
6 SASI_Rn02_00256134 predicted 223
7 SASI_Rn02_00256135 predicted 347
8 SASI_Rn02_00256136 predicted 207
9 SASI_Rn02_00256137 predicted 404
10 SASI_Rn02_00256138 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151099 predicted 289
2 SASI_Mm01_00151100 predicted 215
3 SASI_Mm01_00151101 predicted 252
4 SASI_Mm01_00151102 predicted 260
5 SASI_Mm01_00151103 predicted 217
6 SASI_Mm01_00151104 predicted 257
7 SASI_Mm01_00151105 predicted 396
8 SASI_Mm01_00151106 predicted 329
9 SASI_Mm01_00151107 predicted 230
10 SASI_Mm01_00151108 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010185
FCER1G MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-164s1c1
Sequence:CCGGCCTACTCTACTGTCGACTCAACTCGAGTTGAGTCGACAGTAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-111s1c1
Sequence:CCGGCAGCTCTGCTATATCCTGGATCTCGAGATCCAGGATATAGCAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-189s1c1
Sequence:CCGGCAGGTCCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-217s1c1
Sequence:CCGGGTGAGAAAGCAGATGCTGTCTCTCGAGAGACAGCATCTGCTTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-272s1c1
Sequence:CCGGTGAGACTCTGAAGCATGAGAACTCGAGTTCTCATGCTTCAGAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010185
FCER1G MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-164s1c1
Sequence:CCGGCCTACTCTACTGTCGACTCAACTCGAGTTGAGTCGACAGTAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-111s1c1
Sequence:CCGGCAGCTCTGCTATATCCTGGATCTCGAGATCCAGGATATAGCAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-189s1c1
Sequence:CCGGCAGGTCCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-217s1c1
Sequence:CCGGGTGAGAAAGCAGATGCTGTCTCTCGAGAGACAGCATCTGCTTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-272s1c1
Sequence:CCGGTGAGACTCTGAAGCATGAGAACTCGAGTTCTCATGCTTCAGAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010185
FCER1G MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-164s1c1
Sequence:CCGGCCTACTCTACTGTCGACTCAACTCGAGTTGAGTCGACAGTAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-111s1c1
Sequence:CCGGCAGCTCTGCTATATCCTGGATCTCGAGATCCAGGATATAGCAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-189s1c1
Sequence:CCGGCAGGTCCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-217s1c1
Sequence:CCGGGTGAGAAAGCAGATGCTGTCTCTCGAGAGACAGCATCTGCTTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010185.2-272s1c1
Sequence:CCGGTGAGACTCTGAAGCATGAGAACTCGAGTTCTCATGCTTCAGAGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004106
FCER1G MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-265s1c1
Sequence:CCGGGCATGAGAAACCACCACAGTACTCGAGTACTGTGGTGGTTTCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-114s1c1
Sequence:CCGGCCATCCTGTTTCTGTATGGAACTCGAGTTCCATACAGAAACAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-254s1c1
Sequence:CCGGGAGACTCTGAAGCATGAGAAACTCGAGTTTCTCATGCTTCAGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-148s1c1
Sequence:CCGGCCTCTACTGTCGACTGAAGATCTCGAGATCTTCAGTCGACAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-170s1c1
Sequence:CCGGCAAGTGCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004106
FCER1G MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-265s1c1
Sequence:CCGGGCATGAGAAACCACCACAGTACTCGAGTACTGTGGTGGTTTCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-114s1c1
Sequence:CCGGCCATCCTGTTTCTGTATGGAACTCGAGTTCCATACAGAAACAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-254s1c1
Sequence:CCGGGAGACTCTGAAGCATGAGAAACTCGAGTTTCTCATGCTTCAGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-148s1c1
Sequence:CCGGCCTCTACTGTCGACTGAAGATCTCGAGATCTTCAGTCGACAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-170s1c1
Sequence:CCGGCAAGTGCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004106
FCER1G MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-265s1c1
Sequence:CCGGGCATGAGAAACCACCACAGTACTCGAGTACTGTGGTGGTTTCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-114s1c1
Sequence:CCGGCCATCCTGTTTCTGTATGGAACTCGAGTTCCATACAGAAACAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-254s1c1
Sequence:CCGGGAGACTCTGAAGCATGAGAAACTCGAGTTTCTCATGCTTCAGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-148s1c1
Sequence:CCGGCCTCTACTGTCGACTGAAGATCTCGAGATCTTCAGTCGACAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004106.1-170s1c1
Sequence:CCGGCAAGTGCGAAAGGCAGCTATACTCGAGTATAGCTGCCTTTCGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)