EMAIL THIS PAGE TO A FRIEND

FCGR1B

Fc fragment of IgG, high affinity Ib, receptor (CD64)

31 Gene Product Result for
Synonyms: CD64b IGFRB
Species: Human FCGR1B(2210)
UniProtKB ID: Q92637, Q7KZ13, Q92638
Gene ID:
Human(2210) Summary: Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene encodes the low affinity FcgammaRIB receptor that may play an important role in humoral immune response. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301230 ANTI-FCGR1B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004340 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128511 MISSION® esiRNA esiRNA human FCGR1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004340 Rosetta Predictions human pricing
NM_001017986 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304558 predicted 321
2 SASI_Hs01_00039425 predicted 240
3 SASI_Hs01_00039421 predicted 265
4 SASI_Hs02_00304559 predicted 238
5 SASI_Hs01_00039426 predicted 244
6 SASI_Hs01_00039427 predicted 242
7 SASI_Hs01_00039428 predicted 207
8 SASI_Hs01_00039429 predicted 292
9 SASI_Hs02_00304560 predicted 251
10 SASI_Hs01_00039422 predicted 274
11 SASI_Hs01_00039423 predicted 232
12 SASI_Hs01_00039424 predicted 259
13 SASI_Hs01_00039430 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243685 predicted 224
2 SASI_Hs01_00243688 predicted 522
3 SASI_Hs01_00243689 predicted 376
4 SASI_Hs01_00243690 predicted 435
5 SASI_Hs01_00243686 predicted 217
6 SASI_Hs02_00306871 predicted 515
7 SASI_Hs01_00243691 predicted 391
8 SASI_Hs02_00306872 predicted 519
9 SASI_Hs01_00243693 predicted 567
10 SASI_Hs01_00243694 predicted 255
11 SASI_Hs01_00243687 predicted 583
12 SASI_Hs01_00243692 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004340
FCGR1B MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, high affinity Ib, receptor (CD64)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-105s1c1
Sequence:CCGGGAAGGATAAGCTGGTGTACAACTCGAGTTGTACACCAGCTTATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-114s1c1
Sequence:CCGGGCTGGTGTACAATGTGCTTTACTCGAGTAAAGCACATTGTACACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-201s1c1
Sequence:CCGGCATAAGTCACAATGGCACCTACTCGAGTAGGTGCCATTGTGACTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-57s1c1
Sequence:CCGGCAGAGTCTTCATGGAAGGAGACTCGAGTCTCCTTCCATGAAGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-294s1c1
Sequence:CCGGGTTACCAACTCCTGTCTGGTTCTCGAGAACCAGACAGGAGTTGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-140s1c1
Sequence:CCGGGAAATGGCAAAGCCTTTAAGTCTCGAGACTTAAAGGCTTTGCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-418s1c1
Sequence:CCGGGAAATCTCTTTGGATTCTGGTCTCGAGACCAGAATCCAAAGAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-259s1c1
Sequence:CCGGGCAGGAATATCACAATACACTCTCGAGAGTGTATTGTGATATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-153s1c1
Sequence:CCGGCTTTAAGTTCTTCCACTGGAACTCGAGTTCCAGTGGAAGAACTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-147s1c1
Sequence:CCGGCAAAGCCTTTAAGTTCTTCCACTCGAGTGGAAGAACTTAAAGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-257s1c1
Sequence:CCGGCAGCAGGAATATCACAATACACTCGAGTGTATTGTGATATTCCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004340
FCGR1B MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, high affinity Ib, receptor (CD64)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-105s1c1
Sequence:CCGGGAAGGATAAGCTGGTGTACAACTCGAGTTGTACACCAGCTTATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-114s1c1
Sequence:CCGGGCTGGTGTACAATGTGCTTTACTCGAGTAAAGCACATTGTACACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-201s1c1
Sequence:CCGGCATAAGTCACAATGGCACCTACTCGAGTAGGTGCCATTGTGACTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-57s1c1
Sequence:CCGGCAGAGTCTTCATGGAAGGAGACTCGAGTCTCCTTCCATGAAGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-294s1c1
Sequence:CCGGGTTACCAACTCCTGTCTGGTTCTCGAGAACCAGACAGGAGTTGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-140s1c1
Sequence:CCGGGAAATGGCAAAGCCTTTAAGTCTCGAGACTTAAAGGCTTTGCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-418s1c1
Sequence:CCGGGAAATCTCTTTGGATTCTGGTCTCGAGACCAGAATCCAAAGAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-259s1c1
Sequence:CCGGGCAGGAATATCACAATACACTCTCGAGAGTGTATTGTGATATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-153s1c1
Sequence:CCGGCTTTAAGTTCTTCCACTGGAACTCGAGTTCCAGTGGAAGAACTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-147s1c1
Sequence:CCGGCAAAGCCTTTAAGTTCTTCCACTCGAGTGGAAGAACTTAAAGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-257s1c1
Sequence:CCGGCAGCAGGAATATCACAATACACTCGAGTGTATTGTGATATTCCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004340
FCGR1B MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, high affinity Ib, receptor (CD64)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-105s1c1
Sequence:CCGGGAAGGATAAGCTGGTGTACAACTCGAGTTGTACACCAGCTTATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-114s1c1
Sequence:CCGGGCTGGTGTACAATGTGCTTTACTCGAGTAAAGCACATTGTACACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-201s1c1
Sequence:CCGGCATAAGTCACAATGGCACCTACTCGAGTAGGTGCCATTGTGACTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-57s1c1
Sequence:CCGGCAGAGTCTTCATGGAAGGAGACTCGAGTCTCCTTCCATGAAGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-294s1c1
Sequence:CCGGGTTACCAACTCCTGTCTGGTTCTCGAGAACCAGACAGGAGTTGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-140s1c1
Sequence:CCGGGAAATGGCAAAGCCTTTAAGTCTCGAGACTTAAAGGCTTTGCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-418s1c1
Sequence:CCGGGAAATCTCTTTGGATTCTGGTCTCGAGACCAGAATCCAAAGAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-259s1c1
Sequence:CCGGGCAGGAATATCACAATACACTCTCGAGAGTGTATTGTGATATTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004340.1-153s1c1
Sequence:CCGGCTTTAAGTTCTTCCACTGGAACTCGAGTTCCAGTGGAAGAACTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-147s1c1
Sequence:CCGGCAAAGCCTTTAAGTTCTTCCACTCGAGTGGAAGAACTTAAAGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004340.1-257s1c1
Sequence:CCGGCAGCAGGAATATCACAATACACTCGAGTGTATTGTGATATTCCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)