EMAIL THIS PAGE TO A FRIEND

FCN2

ficolin (collagen/fibrinogen domain containing lectin) 2

33 Gene Product Result for
Synonyms: EBP-37 FCNL P35 ficolin-2
Species: Human FCN2(2220), chicken FCN2(417298)
UniProtKB ID: Q15485, A6NFG7, A8K478, Q6IS69, Q7M4P4, Q9UC57
Gene ID:
Human(2220) Summary: The product of this gene belongs to the ficolin family of proteins. This family is characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. This gene is predominantly expressed in the liver, and has been shown to have carbohydrate binding and opsonic activities. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
chicken(417298) ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0564 AQUA Peptide VDGSVDFY[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004108 Rosetta Predictions human pricing
NM_015837 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010956 predicted 695
2 SASI_Hs01_00010957 predicted 755
3 SASI_Hs01_00010958 predicted 698
4 SASI_Hs01_00010960 predicted 727
5 SASI_Hs01_00010961 predicted 605
6 SASI_Hs01_00010963 predicted 705
7 SASI_Hs01_00010964 predicted 759
8 SASI_Hs01_00010965 predicted 597
9 SASI_Hs02_00336931 predicted 647
10 SASI_Hs02_00336932 predicted 811
11 SASI_Hs01_00010959 predicted 773
12 SASI_Hs01_00010962 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154804 predicted 588
2 SASI_Hs01_00154805 predicted 640
3 SASI_Hs01_00154806 predicted 583
4 SASI_Hs01_00154808 predicted 614
5 SASI_Hs01_00154809 predicted 485
6 SASI_Hs01_00154811 predicted 592
7 SASI_Hs01_00154812 predicted 649
8 SASI_Hs01_00154813 predicted 490
9 SASI_Hs02_00348426 predicted 536
10 SASI_Hs02_00348427 predicted 700
11 SASI_Hs01_00154807 predicted 654
12 SASI_Hs01_00154810 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004108
FCN2 MISSION shRNA Bacterial Glycerol Stock
ficolin (collagen/fibrinogen domain containing lectin) 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-595s21c1
Sequence:CCGGGGTGGACTTTGAGGACAACTACTCGAGTAGTTGTCCTCAAAGTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-858s21c1
Sequence:CCGGCTCATGGCAGCTTTGCAAATGCTCGAGCATTTGCAAAGCTGCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-817s1c1
Sequence:CCGGCTGCCATGTGTCAAACCTGAACTCGAGTTCAGGTTTGACACATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-718s1c1
Sequence:CCGGGTTCCACAACAACCAGTCCTTCTCGAGAAGGACTGGTTGTTGTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-757s1c1
Sequence:CCGGCAATGATCTTAACACCGGAAACTCGAGTTTCCGGTGTTAAGATCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-209s1c1
Sequence:CCGGACCAATGGAAAGAGAGGAGAACTCGAGTTCTCCTCTCTTTCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-772s1c1
Sequence:CCGGCGGAAATTGTGCTGTGATGTTCTCGAGAACATCACAGCACAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004108
FCN2 MISSION shRNA shRNA Plasmid DNA
ficolin (collagen/fibrinogen domain containing lectin) 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-595s21c1
Sequence:CCGGGGTGGACTTTGAGGACAACTACTCGAGTAGTTGTCCTCAAAGTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-858s21c1
Sequence:CCGGCTCATGGCAGCTTTGCAAATGCTCGAGCATTTGCAAAGCTGCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-817s1c1
Sequence:CCGGCTGCCATGTGTCAAACCTGAACTCGAGTTCAGGTTTGACACATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-718s1c1
Sequence:CCGGGTTCCACAACAACCAGTCCTTCTCGAGAAGGACTGGTTGTTGTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-757s1c1
Sequence:CCGGCAATGATCTTAACACCGGAAACTCGAGTTTCCGGTGTTAAGATCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-209s1c1
Sequence:CCGGACCAATGGAAAGAGAGGAGAACTCGAGTTCTCCTCTCTTTCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-772s1c1
Sequence:CCGGCGGAAATTGTGCTGTGATGTTCTCGAGAACATCACAGCACAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004108
FCN2 MISSION shRNA Lentiviral Transduction Particles
ficolin (collagen/fibrinogen domain containing lectin) 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-595s21c1
Sequence:CCGGGGTGGACTTTGAGGACAACTACTCGAGTAGTTGTCCTCAAAGTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004108.2-858s21c1
Sequence:CCGGCTCATGGCAGCTTTGCAAATGCTCGAGCATTTGCAAAGCTGCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-817s1c1
Sequence:CCGGCTGCCATGTGTCAAACCTGAACTCGAGTTCAGGTTTGACACATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-718s1c1
Sequence:CCGGGTTCCACAACAACCAGTCCTTCTCGAGAAGGACTGGTTGTTGTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-757s1c1
Sequence:CCGGCAATGATCTTAACACCGGAAACTCGAGTTTCCGGTGTTAAGATCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-209s1c1
Sequence:CCGGACCAATGGAAAGAGAGGAGAACTCGAGTTCTCCTCTCTTTCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004108.1-772s1c1
Sequence:CCGGCGGAAATTGTGCTGTGATGTTCTCGAGAACATCACAGCACAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)