EMAIL THIS PAGE TO A FRIEND

FEM1A

fem-1 homolog a (C. elegans)

43 Gene Product Result for
Synonyms: EPRAP
UniProtKB ID: Q9BSK4, B2RDI3, Q711P8, Q9NPN7, Q9NPW8
Gene ID:
Mouse(14154) feminization 1 homolog a (C. elegans)
Rat(316131) fem-1 homolog a (C. elegans)
Zebrafish(327613) fem-1 homolog a (C. elegans)
cow(516550) fem-1 homolog a (C. elegans)
domestic cat(101082632) fem-1 homolog a (C. elegans)
dog(485032) fem-1 homolog a (C. elegans)
chicken(420157) fem-1 homolog a (C. elegans)
sheep(101113330) fem-1 homolog a (C. elegans)
domestic guinea pig(100720005) fem-1 homolog a (C. elegans)
naked mole-rat(101721586) fem-1 homolog a (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018708 Rosetta Predictions human pricing
NM_001025706 Rosetta Predictions rat pricing
NM_010192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026961 predicted 2542
2 SASI_Hs01_00026964 predicted 1304
3 SASI_Hs01_00026966 predicted 2374
4 SASI_Hs02_00352237 predicted 2332
5 SASI_Hs01_00026968 predicted 2199
6 SASI_Hs01_00026969 predicted 2342
7 SASI_Hs02_00352238 predicted 2555
8 SASI_Hs02_00352239 predicted 271
9 SASI_Hs01_00026962 predicted 1053
10 SASI_Hs01_00026965 predicted 605
11 SASI_Hs01_00026963 predicted 2476
12 SASI_Hs01_00026967 predicted 1734
13 SASI_Hs01_00026970 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041227 predicted 1192
2 SASI_Rn01_00041228 predicted 1068
3 SASI_Rn01_00041229 predicted 1198
4 SASI_Rn01_00041230 predicted 305
5 SASI_Rn01_00041231 predicted 1223
6 SASI_Rn01_00041232 predicted 1197
7 SASI_Rn01_00041234 predicted 550
8 SASI_Rn01_00041235 predicted 951
9 SASI_Rn02_00203324 predicted 1596
10 SASI_Rn01_00041236 predicted 1269
11 SASI_Rn01_00041233 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065889 predicted 2448
2 SASI_Mm01_00065890 predicted 2445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018708
VALIDATED
FEM1A MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog a (C. elegans)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1817s21c1
Sequence:CCAGTCCCTGCACGTGGTCAAAGTGCTCGAGCACTTTGACCACGTGCAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2561s21c1
Sequence:CCGGAGATAACTCCAGCCGCTGAATCTCGAGATTCAGCGGCTGGAGTTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2347s21c1
Sequence:CCGGGTGCTAAGAGGACAGTCTTTCCTCGAGGAAAGACTGTCCTCTTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1349s21c1
Sequence:CCGGGGCAATTTCGAGCGCTGCATCCTCGAGGATGCAGCGCTCGAAATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2213s21c1
Sequence:CCGGGCGGCATAGCAGATGCTCGTTCTCGAGAACGAGCATCTGCTATGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1013s1c1
Sequence:CCGGGCTACGTATGTGGATAAGAAACTCGAGTTTCTTATCCACATACGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018708.1-556s1c1
Sequence:CCGGCCTCATGATCTCGTGCTACAACTCGAGTTGTAGCACGAGATCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1261s1c1
Sequence:CCGGCACTTCCTATTACATCCGTTACTCGAGTAACGGATGTAATAGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1921s1c1
Sequence:CCGGCGCCACCAATGCCTTCAAGAACTCGAGTTCTTGAAGGCATTGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018708
VALIDATED
FEM1A MISSION shRNA shRNA Plasmid DNA
fem-1 homolog a (C. elegans)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1817s21c1
Sequence:CCAGTCCCTGCACGTGGTCAAAGTGCTCGAGCACTTTGACCACGTGCAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2561s21c1
Sequence:CCGGAGATAACTCCAGCCGCTGAATCTCGAGATTCAGCGGCTGGAGTTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2347s21c1
Sequence:CCGGGTGCTAAGAGGACAGTCTTTCCTCGAGGAAAGACTGTCCTCTTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1349s21c1
Sequence:CCGGGGCAATTTCGAGCGCTGCATCCTCGAGGATGCAGCGCTCGAAATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2213s21c1
Sequence:CCGGGCGGCATAGCAGATGCTCGTTCTCGAGAACGAGCATCTGCTATGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1013s1c1
Sequence:CCGGGCTACGTATGTGGATAAGAAACTCGAGTTTCTTATCCACATACGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018708.1-556s1c1
Sequence:CCGGCCTCATGATCTCGTGCTACAACTCGAGTTGTAGCACGAGATCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1261s1c1
Sequence:CCGGCACTTCCTATTACATCCGTTACTCGAGTAACGGATGTAATAGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1921s1c1
Sequence:CCGGCGCCACCAATGCCTTCAAGAACTCGAGTTCTTGAAGGCATTGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018708
VALIDATED
FEM1A MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog a (C. elegans)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1817s21c1
Sequence:CCAGTCCCTGCACGTGGTCAAAGTGCTCGAGCACTTTGACCACGTGCAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2561s21c1
Sequence:CCGGAGATAACTCCAGCCGCTGAATCTCGAGATTCAGCGGCTGGAGTTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2347s21c1
Sequence:CCGGGTGCTAAGAGGACAGTCTTTCCTCGAGGAAAGACTGTCCTCTTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018708.2-1349s21c1
Sequence:CCGGGGCAATTTCGAGCGCTGCATCCTCGAGGATGCAGCGCTCGAAATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018708.2-2213s21c1
Sequence:CCGGGCGGCATAGCAGATGCTCGTTCTCGAGAACGAGCATCTGCTATGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1013s1c1
Sequence:CCGGGCTACGTATGTGGATAAGAAACTCGAGTTTCTTATCCACATACGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018708.1-556s1c1
Sequence:CCGGCCTCATGATCTCGTGCTACAACTCGAGTTGTAGCACGAGATCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1261s1c1
Sequence:CCGGCACTTCCTATTACATCCGTTACTCGAGTAACGGATGTAATAGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018708.1-1921s1c1
Sequence:CCGGCGCCACCAATGCCTTCAAGAACTCGAGTTCTTGAAGGCATTGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010192
FEM1A MISSION shRNA Bacterial Glycerol Stock
fem-1 homolog a (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-1967s21c1
Sequence:CCGGGCCTTTCAATTATGTGACACTCTCGAGAGTGTCACATAATTGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-910s21c1
Sequence:CCGGCAGAAGAAGCAGAACCGTATGCTCGAGCATACGGTTCTGCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010192.4-2482s21c1
Sequence:CCGGAGTTGAGAGTTGCCAGTATTTCTCGAGAAATACTGGCAACTCTCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-547s1c1
Sequence:CCGGCCTTATGATCTCCTGCTACAACTCGAGTTGTAGCAGGAGATCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010192.2-3311s1c1
Sequence:CCGGGCCTAGCTGTTATTTAATGTACTCGAGTACATTAAATAACAGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-959s1c1
Sequence:CCGGGCCACCTACGTGGATAAGAAACTCGAGTTTCTTATCCACGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1127s1c1
Sequence:CCGGGCCCTCATTACAGATCCTGATCTCGAGATCAGGATCTGTAATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1985s1c1
Sequence:CCGGGACAGGAACAAGGTCCCTTATCTCGAGATAAGGGACCTTGTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010192
FEM1A MISSION shRNA shRNA Plasmid DNA
fem-1 homolog a (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-1967s21c1
Sequence:CCGGGCCTTTCAATTATGTGACACTCTCGAGAGTGTCACATAATTGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-910s21c1
Sequence:CCGGCAGAAGAAGCAGAACCGTATGCTCGAGCATACGGTTCTGCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010192.4-2482s21c1
Sequence:CCGGAGTTGAGAGTTGCCAGTATTTCTCGAGAAATACTGGCAACTCTCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-547s1c1
Sequence:CCGGCCTTATGATCTCCTGCTACAACTCGAGTTGTAGCAGGAGATCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010192.2-3311s1c1
Sequence:CCGGGCCTAGCTGTTATTTAATGTACTCGAGTACATTAAATAACAGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-959s1c1
Sequence:CCGGGCCACCTACGTGGATAAGAAACTCGAGTTTCTTATCCACGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1127s1c1
Sequence:CCGGGCCCTCATTACAGATCCTGATCTCGAGATCAGGATCTGTAATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1985s1c1
Sequence:CCGGGACAGGAACAAGGTCCCTTATCTCGAGATAAGGGACCTTGTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010192
FEM1A MISSION shRNA Lentiviral Transduction Particles
fem-1 homolog a (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-1967s21c1
Sequence:CCGGGCCTTTCAATTATGTGACACTCTCGAGAGTGTCACATAATTGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010192.4-910s21c1
Sequence:CCGGCAGAAGAAGCAGAACCGTATGCTCGAGCATACGGTTCTGCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010192.4-2482s21c1
Sequence:CCGGAGTTGAGAGTTGCCAGTATTTCTCGAGAAATACTGGCAACTCTCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-547s1c1
Sequence:CCGGCCTTATGATCTCCTGCTACAACTCGAGTTGTAGCAGGAGATCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010192.2-3311s1c1
Sequence:CCGGGCCTAGCTGTTATTTAATGTACTCGAGTACATTAAATAACAGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-959s1c1
Sequence:CCGGGCCACCTACGTGGATAAGAAACTCGAGTTTCTTATCCACGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1127s1c1
Sequence:CCGGGCCCTCATTACAGATCCTGATCTCGAGATCAGGATCTGTAATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010192.2-1985s1c1
Sequence:CCGGGACAGGAACAAGGTCCCTTATCTCGAGATAAGGGACCTTGTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)