EMAIL THIS PAGE TO A FRIEND

FGF14

fibroblast growth factor 14

105 Gene Product Result for
Synonyms: FGF-14 FHF-4 FHF4 SCA27
UniProtKB ID: Q92915, Q86YN7, Q96QX6
Gene ID:
Human(2259) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14169) fibroblast growth factor 14
Rat(63851) fibroblast growth factor 14
Zebrafish(497642) fibroblast growth factor 14
cow(615488) fibroblast growth factor 14
domestic cat(101082119) fibroblast growth factor 14
dog(485537) fibroblast growth factor 14
chicken(395554) fibroblast growth factor 14
domestic guinea pig(100721281) fibroblast growth factor 14
naked mole-rat(101701669) fibroblast growth factor 14
sheep(101113249) fibroblast growth factor 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004115 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070371 MISSION® esiRNA esiRNA human FGF14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004115 Rosetta Predictions human pricing
NM_175929 Rosetta Predictions human pricing
NM_022223 Rosetta Predictions rat pricing
NM_010201 Rosetta Predictions mouse pricing
NM_207667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336951 predicted 971
2 SASI_Hs02_00336952 predicted 841
3 SASI_Hs02_00336953 predicted 1021
4 SASI_Hs02_00336954 predicted 680
5 SASI_Hs02_00336955 predicted 1038
6 SASI_Hs01_00084511 predicted 590
7 SASI_Hs02_00336956 predicted 939
8 SASI_Hs01_00084513 predicted 422
9 SASI_Hs02_00336957 predicted 762
10 SASI_Hs01_00084515 predicted 457
11 SASI_Hs01_00084509 predicted 400
12 SASI_Hs01_00084510 predicted 546
13 SASI_Hs01_00084512 predicted 592
14 SASI_Hs01_00084514 predicted 396
15 SASI_Hs01_00084516 predicted 526
16 SASI_Hs01_00084517 predicted 425
17 SASI_Hs01_00084518 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369183 predicted 1078
2 SASI_Hs02_00369184 predicted 949
3 SASI_Hs02_00369185 predicted 1135
4 SASI_Hs02_00369186 predicted 790
5 SASI_Hs02_00369187 predicted 1143
6 SASI_Hs01_00061932 predicted 704
7 SASI_Hs02_00369188 predicted 1052
8 SASI_Hs01_00061934 predicted 532
9 SASI_Hs02_00369189 predicted 875
10 SASI_Hs01_00061937 predicted 569
11 SASI_Hs01_00061930 predicted 509
12 SASI_Hs01_00061931 predicted 656
13 SASI_Hs01_00061933 predicted 707
14 SASI_Hs01_00061935 predicted 508
15 SASI_Hs01_00061936 predicted 508
16 SASI_Hs01_00061938 predicted 642
17 SASI_Hs01_00061939 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262986 predicted 355
2 SASI_Rn01_00083462 predicted 396
3 SASI_Rn01_00083463 predicted 373
4 SASI_Rn01_00083464 predicted 372
5 SASI_Rn01_00083465 predicted 357
6 SASI_Rn01_00083466 predicted 349
7 SASI_Rn01_00083467 predicted 266
8 SASI_Rn01_00083468 predicted 345
9 SASI_Rn01_00083469 predicted 388
10 SASI_Rn01_00083470 predicted 344
11 SASI_Rn01_00083461 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108570 predicted 988
2 SASI_Mm01_00108571 predicted 968
3 SASI_Mm02_00318008 predicted 1207
4 SASI_Mm02_00318009 predicted 1053
5 SASI_Mm01_00108573 predicted 491
6 SASI_Mm02_00318010 predicted 1125
7 SASI_Mm02_00318011 predicted 810
8 SASI_Mm01_00108577 predicted 621
9 SASI_Mm02_00318012 predicted 447
10 SASI_Mm02_00318013 predicted 740
11 SASI_Mm01_00108569 predicted 1259
12 SASI_Mm01_00108572 predicted 1091
13 SASI_Mm01_00108574 predicted 1233
14 SASI_Mm01_00108575 predicted 1019
15 SASI_Mm01_00108576 predicted 1019
16 SASI_Mm01_00108578 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032744 predicted 1392
2 SASI_Mm01_00032745 predicted 1366
3 SASI_Mm02_00352190 predicted 1603
4 SASI_Mm02_00352191 predicted 1451
5 SASI_Mm01_00032747 predicted 889
6 SASI_Mm02_00352192 predicted 1521
7 SASI_Mm02_00352193 predicted 1215
8 SASI_Mm01_00032751 predicted 1023
9 SASI_Mm02_00352194 predicted 850
10 SASI_Mm02_00352195 predicted 1143
11 SASI_Mm01_00032743 predicted 1292
12 SASI_Mm01_00032746 predicted 1138
13 SASI_Mm01_00032748 predicted 1274
14 SASI_Mm01_00032749 predicted 1061
15 SASI_Mm01_00032750 predicted 1056
16 SASI_Mm01_00032752 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010201
FGF14 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 14
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-1013s1c1
Sequence:CCGGCCTTGCATGATGTTGGTGAAACTCGAGTTTCACCAACATCATGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-665s1c1
Sequence:CCGGCCAAGGATGACAGCACCAATTCTCGAGAATTGGTGCTGTCATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-812s1c1
Sequence:CCGGGCAAGTTTAAAGAGTCTGTTTCTCGAGAAACAGACTCTTTAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-618s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAGATCTCGAGATCTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010201
FGF14 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 14
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-1013s1c1
Sequence:CCGGCCTTGCATGATGTTGGTGAAACTCGAGTTTCACCAACATCATGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-665s1c1
Sequence:CCGGCCAAGGATGACAGCACCAATTCTCGAGAATTGGTGCTGTCATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-812s1c1
Sequence:CCGGGCAAGTTTAAAGAGTCTGTTTCTCGAGAAACAGACTCTTTAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-618s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAGATCTCGAGATCTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010201
FGF14 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 14
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-1013s1c1
Sequence:CCGGCCTTGCATGATGTTGGTGAAACTCGAGTTTCACCAACATCATGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-665s1c1
Sequence:CCGGCCAAGGATGACAGCACCAATTCTCGAGAATTGGTGCTGTCATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-812s1c1
Sequence:CCGGGCAAGTTTAAAGAGTCTGTTTCTCGAGAAACAGACTCTTTAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010201.2-618s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAGATCTCGAGATCTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004115
FGF14 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-697s1c1
Sequence:CCGGGCAATAATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-597s1c1
Sequence:CCGGGCCATTGGAAGTTGCCATGTACTCGAGTACATGGCAACTTCCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-421s1c1
Sequence:CCGGCCTGAATGCAAGTTTAAAGAACTCGAGTTCTTTAAACTTGCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-234s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAAATCTCGAGATTTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-291s1c1
Sequence:CCGGCAGCACTAATTCTACACTCTTCTCGAGAAGAGTGTAGAATTAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-961s21c1
Sequence:CCGGATGGAATGCCCTACCAGATATCTCGAGATATCTGGTAGGGCATTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-1158s21c1
Sequence:CCGGTTTCTAGTTAGACGCTGTAAACTCGAGTTTACAGCGTCTAACTAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-365s21c1
Sequence:CCGGGGTTGTATATAGCCATGAATGCTCGAGCATTCATGGCTATATACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-209s21c1
Sequence:CCGGGTATAGTGACCAGGTTATATTCTCGAGAATATAACCTGGTCACTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004115
FGF14 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-697s1c1
Sequence:CCGGGCAATAATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-597s1c1
Sequence:CCGGGCCATTGGAAGTTGCCATGTACTCGAGTACATGGCAACTTCCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-421s1c1
Sequence:CCGGCCTGAATGCAAGTTTAAAGAACTCGAGTTCTTTAAACTTGCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-234s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAAATCTCGAGATTTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-291s1c1
Sequence:CCGGCAGCACTAATTCTACACTCTTCTCGAGAAGAGTGTAGAATTAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-961s21c1
Sequence:CCGGATGGAATGCCCTACCAGATATCTCGAGATATCTGGTAGGGCATTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-1158s21c1
Sequence:CCGGTTTCTAGTTAGACGCTGTAAACTCGAGTTTACAGCGTCTAACTAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-365s21c1
Sequence:CCGGGGTTGTATATAGCCATGAATGCTCGAGCATTCATGGCTATATACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-209s21c1
Sequence:CCGGGTATAGTGACCAGGTTATATTCTCGAGAATATAACCTGGTCACTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004115
FGF14 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-697s1c1
Sequence:CCGGGCAATAATGAATGGAGGCAAACTCGAGTTTGCCTCCATTCATTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-597s1c1
Sequence:CCGGGCCATTGGAAGTTGCCATGTACTCGAGTACATGGCAACTTCCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-421s1c1
Sequence:CCGGCCTGAATGCAAGTTTAAAGAACTCGAGTTCTTTAAACTTGCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-234s1c1
Sequence:CCGGGCAAGGCTACTACTTGCAAATCTCGAGATTTGCAAGTAGTAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004115.2-291s1c1
Sequence:CCGGCAGCACTAATTCTACACTCTTCTCGAGAAGAGTGTAGAATTAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-961s21c1
Sequence:CCGGATGGAATGCCCTACCAGATATCTCGAGATATCTGGTAGGGCATTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004115.3-1158s21c1
Sequence:CCGGTTTCTAGTTAGACGCTGTAAACTCGAGTTTACAGCGTCTAACTAGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-365s21c1
Sequence:CCGGGGTTGTATATAGCCATGAATGCTCGAGCATTCATGGCTATATACAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004115.3-209s21c1
Sequence:CCGGGTATAGTGACCAGGTTATATTCTCGAGAATATAACCTGGTCACTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)