EMAIL THIS PAGE TO A FRIEND

FGF3

fibroblast growth factor 3

51 Gene Product Result for
Synonyms: HBGF-3 INT2
UniProtKB ID: P11487, Q0VG69
Gene ID:
Human(2248) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008]
Mouse(14174) fibroblast growth factor 3
Rat(170633) fibroblast growth factor 3
Zebrafish(30549) fibroblast growth factor 3
chicken(396267) fibroblast growth factor 3
cow(281162) fibroblast growth factor 3
cow(618481) fibroblast growth factor 3
dog(611707) fibroblast growth factor 3
domestic guinea pig(100716446) fibroblast growth factor 3
naked mole-rat(101710458) fibroblast growth factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1459 Human FGF-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029261 MISSION® esiRNA esiRNA targeting mouse Fgf3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005247 Rosetta Predictions human pricing
NM_130817 Rosetta Predictions rat pricing
NM_008007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186155 predicted 845
2 SASI_Hs01_00186156 predicted 880
3 SASI_Hs01_00186157 predicted 1230
4 SASI_Hs01_00186158 predicted 1254
5 SASI_Hs01_00186159 predicted 826
6 SASI_Hs01_00186160 predicted 936
7 SASI_Hs01_00186161 predicted 1153
8 SASI_Hs01_00186162 predicted 1123
9 SASI_Hs02_00339264 predicted 1050
10 SASI_Hs01_00186163 predicted 881
11 SASI_Hs01_00186164 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089057 predicted 275
2 SASI_Rn01_00089058 predicted 336
3 SASI_Rn01_00089059 predicted 353
4 SASI_Rn01_00089060 predicted 302
5 SASI_Rn01_00089061 predicted 504
6 SASI_Rn01_00089062 predicted 441
7 SASI_Rn01_00089063 predicted 305
8 SASI_Rn01_00089064 predicted 296
9 SASI_Rn01_00089065 predicted 306
10 SASI_Rn01_00089066 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080965 predicted 370
2 SASI_Mm02_00312942 predicted 934
3 SASI_Mm01_00080966 predicted 399
4 SASI_Mm01_00080967 predicted 545
5 SASI_Mm01_00080968 predicted 430
6 SASI_Mm02_00312943 predicted 294
7 SASI_Mm01_00080971 predicted 543
8 SASI_Mm01_00080972 predicted 319
9 SASI_Mm02_00312944 predicted 868
10 SASI_Mm02_00312945 predicted 783
11 SASI_Mm01_00080969 predicted 456
12 SASI_Mm01_00080970 predicted 318
13 SASI_Mm01_00080973 predicted 309
14 SASI_Mm01_00080974 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005247
FGF3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005247.2-1311s21c1
Sequence:CCGGGTCTGGGTTCTCAGCTATTTCCTCGAGGAAATAGCTGAGAACCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-1160s21c1
Sequence:CCGGTCACGTTCAGGCTTCGAGACTCTCGAGAGTCTCGAAGCCTGAACGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-940s21c1
Sequence:CCGGAGAGACTGTGGTACGTGTCTGCTCGAGCAGACACGTACCACAGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1125s1c1
Sequence:CCGGCGGCAGAAGCAGAGCCCGGATCTCGAGATCCGGGCTCTGCTTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1004s1c1
Sequence:CCGGCACACAGAAGTCCTCCCTGTTCTCGAGAACAGGGAGGACTTCTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-803s1c1
Sequence:CCGGACTCTATGCTTCGGAGCACTACTCGAGTAGTGCTCCGAAGCATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-629s1c1
Sequence:CCGGCAAGCTCTACTGCGCCACGAACTCGAGTTCGTGGCGCAGTAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-858s1c1
Sequence:CCGGGAGCTGGGCTATAATACGTATCTCGAGATACGTATTATAGCCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005247
FGF3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005247.2-1311s21c1
Sequence:CCGGGTCTGGGTTCTCAGCTATTTCCTCGAGGAAATAGCTGAGAACCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-1160s21c1
Sequence:CCGGTCACGTTCAGGCTTCGAGACTCTCGAGAGTCTCGAAGCCTGAACGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-940s21c1
Sequence:CCGGAGAGACTGTGGTACGTGTCTGCTCGAGCAGACACGTACCACAGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1125s1c1
Sequence:CCGGCGGCAGAAGCAGAGCCCGGATCTCGAGATCCGGGCTCTGCTTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1004s1c1
Sequence:CCGGCACACAGAAGTCCTCCCTGTTCTCGAGAACAGGGAGGACTTCTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-803s1c1
Sequence:CCGGACTCTATGCTTCGGAGCACTACTCGAGTAGTGCTCCGAAGCATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-629s1c1
Sequence:CCGGCAAGCTCTACTGCGCCACGAACTCGAGTTCGTGGCGCAGTAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-858s1c1
Sequence:CCGGGAGCTGGGCTATAATACGTATCTCGAGATACGTATTATAGCCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005247
FGF3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005247.2-1311s21c1
Sequence:CCGGGTCTGGGTTCTCAGCTATTTCCTCGAGGAAATAGCTGAGAACCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-1160s21c1
Sequence:CCGGTCACGTTCAGGCTTCGAGACTCTCGAGAGTCTCGAAGCCTGAACGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005247.2-940s21c1
Sequence:CCGGAGAGACTGTGGTACGTGTCTGCTCGAGCAGACACGTACCACAGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1125s1c1
Sequence:CCGGCGGCAGAAGCAGAGCCCGGATCTCGAGATCCGGGCTCTGCTTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-1004s1c1
Sequence:CCGGCACACAGAAGTCCTCCCTGTTCTCGAGAACAGGGAGGACTTCTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-803s1c1
Sequence:CCGGACTCTATGCTTCGGAGCACTACTCGAGTAGTGCTCCGAAGCATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-629s1c1
Sequence:CCGGCAAGCTCTACTGCGCCACGAACTCGAGTTCGTGGCGCAGTAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005247.2-858s1c1
Sequence:CCGGGAGCTGGGCTATAATACGTATCTCGAGATACGTATTATAGCCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008007
FGF3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-312s1c1
Sequence:CCGGGCTGTATGCTTCGGATCACTACTCGAGTAGTGATCCGAAGCATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-213s1c1
Sequence:CCGGCGCCTATAGCATCCTGGAGATCTCGAGATCTCCAGGATGCTATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-367s1c1
Sequence:CCGGGAGCTGGGCTACAATACATATCTCGAGATATGTATTGTAGCCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-454s1c1
Sequence:CCGGCCTTGGTACGTGTCGGTGAATCTCGAGATTCACCGACACGTACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-337s1c1
Sequence:CCGGGCAGAGTGTGAGTTTGTGGAACTCGAGTTCCACAAACTCACACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008007
FGF3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-312s1c1
Sequence:CCGGGCTGTATGCTTCGGATCACTACTCGAGTAGTGATCCGAAGCATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-213s1c1
Sequence:CCGGCGCCTATAGCATCCTGGAGATCTCGAGATCTCCAGGATGCTATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-367s1c1
Sequence:CCGGGAGCTGGGCTACAATACATATCTCGAGATATGTATTGTAGCCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-454s1c1
Sequence:CCGGCCTTGGTACGTGTCGGTGAATCTCGAGATTCACCGACACGTACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-337s1c1
Sequence:CCGGGCAGAGTGTGAGTTTGTGGAACTCGAGTTCCACAAACTCACACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008007
FGF3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-312s1c1
Sequence:CCGGGCTGTATGCTTCGGATCACTACTCGAGTAGTGATCCGAAGCATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-213s1c1
Sequence:CCGGCGCCTATAGCATCCTGGAGATCTCGAGATCTCCAGGATGCTATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-367s1c1
Sequence:CCGGGAGCTGGGCTACAATACATATCTCGAGATATGTATTGTAGCCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-454s1c1
Sequence:CCGGCCTTGGTACGTGTCGGTGAATCTCGAGATTCACCGACACGTACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008007.1-337s1c1
Sequence:CCGGGCAGAGTGTGAGTTTGTGGAACTCGAGTTCCACAAACTCACACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)