EMAIL THIS PAGE TO A FRIEND

FGFR1

fibroblast growth factor receptor 1

322 Gene Product Result for
Synonyms: BFGFR CD331 CEK FGFBR FGFR-1 FLG FLT-2 FLT2 HBGFR HH2 KAL2 N-SAM OGD bFGF-R-1
Gene ID:
Human(2260) Summary: The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(14182) fibroblast growth factor receptor 1
Rat(79114) Fibroblast growth factor receptor 1
Domestic Rabbit(100351861) fibroblast growth factor receptor 1
domestic guinea pig(100731156) fibroblast growth factor receptor 1
naked mole-rat(101700324) fibroblast growth factor receptor 1
chicken(396516) fibroblast growth factor receptor 1
dog(475582) fibroblast growth factor receptor 1
cow(281768) fibroblast growth factor receptor 1
Horse(100057614) fibroblast growth factor receptor 1
domestic cat(101086055) fibroblast growth factor receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306302 ANTI-BI-PHOSPHO-FGFR(Y653/654) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1105679 Anti-FGFR1 (496-510) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105680 Anti-FGFR1 (771-785) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300488 Anti-FGFR1 (Ab-154) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB2500394 Anti-FGFR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2502015 Anti-FGFR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, bovine
ELISA, western blot pricing
SAB1412030 ANTI-FGFR1 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412272 ANTI-FGFR1 antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412273 ANTI-FGFR1 antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412274 ANTI-FGFR1 antibody produced in mouse clone 3C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412275 ANTI-FGFR1 antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412276 ANTI-FGFR1 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412611 ANTI-FGFR1 antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA056402 Anti-FGFR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500887 Anti-FGFR1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
HPA076274 Anti-FGFR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4500885 Anti-FGFR1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500886 Anti-FGFR1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
F5421 Anti-Fibroblast Growth Factor Receptor-1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1302592 ANTI-MOUSE FGFR1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306303 ANTI-PHOSPHO-FGFR(Y766) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB4504406 Anti-phospho-FGFR1 (pTyr154) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4503915 Anti-phospho-FGFR1 (pTyr654) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4301510 Anti-phospho-FGFR1 (pTyr654) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4503914 Anti-phospho-FGFR1 (pTyr766) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301441 Anti-phospho-FGFR1 (pTyr766) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
WH0002260M3 Monoclonal Anti-FGFR1 antibody produced in mouse clone 5E9, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1403814 Monoclonal Anti-FGFR1 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300469 Monoclonal Anti-FGFR1 antibody produced in mouse clone 3D4F7, ascites fluid human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P19809 2-Phenylbenzimidazole 97% human pricing
P2499 PD 173074 ≥96% (HPLC), powder human, mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0428 AQUA Peptide SPHRPILQAGLPAN[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015850 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_000604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000604 Rosetta Predictions human pricing
NM_015850 Rosetta Predictions human pricing
NM_023105 Rosetta Predictions human pricing
NM_023106 Rosetta Predictions human pricing
NM_023107 Rosetta Predictions human pricing
NM_023108 Rosetta Predictions human pricing
NM_023110 Rosetta Predictions human pricing
NM_023111 Rosetta Predictions human pricing
NM_024146 Rosetta Predictions rat pricing
NM_001079908 Rosetta Predictions mouse pricing
NM_001079909 Rosetta Predictions mouse pricing
NM_010206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126674 predicted 1532
2 SASI_Hs01_00126675 predicted 1655
3 SASI_Hs01_00126676 predicted 2397
4 SASI_Hs01_00126677 predicted 1618
5 SASI_Hs01_00126678 predicted 2048
6 SASI_Hs01_00126679 predicted 1596
7 SASI_Hs01_00126680 predicted 1633
8 SASI_Hs01_00126681 predicted 2303
9 SASI_Hs01_00126682 predicted 2289
10 SASI_Hs01_00126683 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192364 predicted 1626
2 SASI_Hs01_00192365 predicted 1633
3 SASI_Hs01_00192366 predicted 1618
4 SASI_Hs01_00192367 predicted 1619
5 SASI_Hs01_00192368 predicted 1595
6 SASI_Hs02_00348438 predicted 1610
7 SASI_Hs01_00192369 predicted 1609
8 SASI_Hs02_00348439 predicted 1590
9 SASI_Hs01_00192371 predicted 1635
10 SASI_Hs01_00192372 predicted 1615
11 SASI_Hs01_00192370 predicted 1422
12 SASI_Hs01_00192373 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356334 predicted 1371
2 SASI_Hs02_00356335 predicted 1376
3 SASI_Hs02_00356336 predicted 1354
4 SASI_Hs02_00356337 predicted 1355
5 SASI_Hs02_00356338 predicted 1335
6 SASI_Hs02_00356339 predicted 1351
7 SASI_Hs02_00356340 predicted 1352
8 SASI_Hs02_00356341 predicted 1335
9 SASI_Hs02_00356342 predicted 1372
10 SASI_Hs02_00356343 predicted 1349
11 SASI_Hs01_00152229 predicted 1263
12 SASI_Hs01_00152230 predicted 1390
13 SASI_Hs01_00152231 predicted 2129
14 SASI_Hs01_00152232 predicted 1349
15 SASI_Hs01_00152233 predicted 1777
16 SASI_Hs01_00152234 predicted 1330
17 SASI_Hs01_00152235 predicted 1368
18 SASI_Hs01_00152236 predicted 2032
19 SASI_Hs01_00152237 predicted 2019
20 SASI_Hs01_00152238 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192204 predicted 1360
2 SASI_Hs01_00192205 predicted 1370
3 SASI_Hs01_00192206 predicted 1353
4 SASI_Hs01_00192207 predicted 1348
5 SASI_Hs01_00192208 predicted 1331
6 SASI_Hs02_00356344 predicted 1349
7 SASI_Hs01_00192209 predicted 1339
8 SASI_Hs02_00356345 predicted 1326
9 SASI_Hs01_00192211 predicted 1368
10 SASI_Hs01_00192212 predicted 1347
11 SASI_Hs01_00192210 predicted 1174
12 SASI_Hs01_00192213 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030099 predicted 1365
2 SASI_Hs01_00030100 predicted 1374
3 SASI_Hs01_00030101 predicted 1353
4 SASI_Hs01_00030102 predicted 1357
5 SASI_Hs01_00030103 predicted 1331
6 SASI_Hs02_00356346 predicted 1350
7 SASI_Hs01_00030104 predicted 1352
8 SASI_Hs02_00356347 predicted 1336
9 SASI_Hs01_00030106 predicted 1372
10 SASI_Hs01_00030107 predicted 1350
11 SASI_Hs01_00030105 predicted 1162
12 SASI_Hs01_00030108 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085533 predicted 1365
2 SASI_Hs01_00085534 predicted 1366
3 SASI_Hs01_00085535 predicted 1346
4 SASI_Hs01_00085536 predicted 1347
5 SASI_Hs01_00085537 predicted 1324
6 SASI_Hs02_00356348 predicted 1350
7 SASI_Hs01_00085538 predicted 1345
8 SASI_Hs02_00356349 predicted 1324
9 SASI_Hs01_00085540 predicted 1365
10 SASI_Hs01_00085541 predicted 1350
11 SASI_Hs01_00085539 predicted 1163
12 SASI_Hs01_00085542 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356350 predicted 1633
2 SASI_Hs02_00356351 predicted 1641
3 SASI_Hs02_00356352 predicted 1627
4 SASI_Hs02_00356353 predicted 1623
5 SASI_Hs02_00356354 predicted 1597
6 SASI_Hs02_00356355 predicted 1619
7 SASI_Hs02_00356356 predicted 1612
8 SASI_Hs02_00356357 predicted 1595
9 SASI_Hs02_00356358 predicted 1637
10 SASI_Hs02_00356359 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076822 predicted 1636
2 SASI_Hs01_00076823 predicted 1639
3 SASI_Hs01_00076824 predicted 1626
4 SASI_Hs01_00076825 predicted 1621
5 SASI_Hs01_00076826 predicted 1606
6 SASI_Hs02_00356360 predicted 1619
7 SASI_Hs01_00076827 predicted 1616
8 SASI_Hs02_00356361 predicted 1596
9 SASI_Hs01_00076829 predicted 1640
10 SASI_Hs01_00076830 predicted 1621
11 SASI_Hs01_00076828 predicted 1429
12 SASI_Hs01_00076831 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116554 predicted 912
2 SASI_Rn01_00116558 predicted 1680
3 SASI_Rn02_00263872 predicted 887
4 SASI_Rn02_00263873 predicted 1523
5 SASI_Rn01_00116555 predicted 2009
6 SASI_Rn01_00116556 predicted 2180
7 SASI_Rn01_00116557 predicted 1940
8 SASI_Rn01_00116559 predicted 1902
9 SASI_Rn01_00116560 predicted 2179
10 SASI_Rn01_00116561 predicted 1881
11 SASI_Rn01_00116562 predicted 2240
12 SASI_Rn01_00116563 predicted 2165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293252 predicted 1662
2 SASI_Mm02_00293253 predicted 2643
3 SASI_Mm02_00293254 predicted 2751
4 SASI_Mm02_00293255 predicted 3031
5 SASI_Mm02_00293256 predicted 2432
6 SASI_Mm02_00293257 predicted 2905
7 SASI_Mm02_00293258 predicted 1679
8 SASI_Mm02_00293259 predicted 2666
9 SASI_Mm02_00293260 predicted 1840
10 SASI_Mm02_00293261 predicted 2119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293262 predicted 1403
2 SASI_Mm02_00293263 predicted 2378
3 SASI_Mm02_00293264 predicted 2490
4 SASI_Mm02_00293265 predicted 2769
5 SASI_Mm02_00293266 predicted 2177
6 SASI_Mm02_00293267 predicted 2643
7 SASI_Mm02_00293268 predicted 1422
8 SASI_Mm02_00293269 predicted 2398
9 SASI_Mm02_00293270 predicted 1574
10 SASI_Mm02_00293271 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318028 predicted 1676
2 SASI_Mm01_00035487 predicted 2645
3 SASI_Mm01_00035488 predicted 2748
4 SASI_Mm02_00318029 predicted 3039
5 SASI_Mm01_00035489 predicted 2444
6 SASI_Mm01_00035490 predicted 2913
7 SASI_Mm01_00035492 predicted 1682
8 SASI_Mm01_00035493 predicted 2673
9 SASI_Mm01_00035494 predicted 1841
10 SASI_Mm01_00035495 predicted 2125
11 SASI_Mm01_00035486 predicted 643
12 SASI_Mm01_00035491 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010206
VALIDATED
FGFR1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1678s21c1
Sequence:CCGGTGAAGACTGCTGGAGTTAATACTCGAGTATTAACTCCAGCAGTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1078s21c1
Sequence:CCGGCCACCTACTTCTCCGTCAATGCTCGAGCATTGACGGAGAAGTAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3670s21c1
Sequence:CCGGAGTAGCTTCTTAATTCCAATACTCGAGTATTGGAATTAAGAAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1861s21c1
Sequence:CCGGCGCTCTACCTGGAGATCATTACTCGAGTAATGATCTCCAGGTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1336s21c1
Sequence:CCGGTTAAGCCTGACCACCGAATTGCTCGAGCAATTCGGTGGTCAGGCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1381s21c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2637s21c1
Sequence:CCGGGTGACCGAGGATAACGTAATGCTCGAGCATTACGTTATCCTCGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2115s21c1
Sequence:CCGGCTGGCTGGAGTCTCCGAATATCTCGAGATATTCGGAGACTCCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3615s21c1
Sequence:CCGGAGGTTTCTGTTTAGGCCTTAACTCGAGTTAAGGCCTAAACAGAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-1897s1c1
Sequence:CCGGCTTGCCTCTAAGAAGTGTATACTCGAGTATACACTTCTTAGAGGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-564s1c1
Sequence:CCGGCGCTGCCAAGACGGTGAAGTTCTCGAGAACTTCACCGTCTTGGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-1953s1c1
Sequence:CCGGCGAGGATAACGTAATGAAGATCTCGAGATCTTCATTACGTTATCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-692s1c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010206
VALIDATED
FGFR1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1678s21c1
Sequence:CCGGTGAAGACTGCTGGAGTTAATACTCGAGTATTAACTCCAGCAGTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1078s21c1
Sequence:CCGGCCACCTACTTCTCCGTCAATGCTCGAGCATTGACGGAGAAGTAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3670s21c1
Sequence:CCGGAGTAGCTTCTTAATTCCAATACTCGAGTATTGGAATTAAGAAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1861s21c1
Sequence:CCGGCGCTCTACCTGGAGATCATTACTCGAGTAATGATCTCCAGGTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1336s21c1
Sequence:CCGGTTAAGCCTGACCACCGAATTGCTCGAGCAATTCGGTGGTCAGGCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1381s21c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2637s21c1
Sequence:CCGGGTGACCGAGGATAACGTAATGCTCGAGCATTACGTTATCCTCGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2115s21c1
Sequence:CCGGCTGGCTGGAGTCTCCGAATATCTCGAGATATTCGGAGACTCCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3615s21c1
Sequence:CCGGAGGTTTCTGTTTAGGCCTTAACTCGAGTTAAGGCCTAAACAGAAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-1897s1c1
Sequence:CCGGCTTGCCTCTAAGAAGTGTATACTCGAGTATACACTTCTTAGAGGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-564s1c1
Sequence:CCGGCGCTGCCAAGACGGTGAAGTTCTCGAGAACTTCACCGTCTTGGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-1953s1c1
Sequence:CCGGCGAGGATAACGTAATGAAGATCTCGAGATCTTCATTACGTTATCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-692s1c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010206
VALIDATED
FGFR1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1678s21c1
Sequence:CCGGTGAAGACTGCTGGAGTTAATACTCGAGTATTAACTCCAGCAGTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1078s21c1
Sequence:CCGGCCACCTACTTCTCCGTCAATGCTCGAGCATTGACGGAGAAGTAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3670s21c1
Sequence:CCGGAGTAGCTTCTTAATTCCAATACTCGAGTATTGGAATTAAGAAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1861s21c1
Sequence:CCGGCGCTCTACCTGGAGATCATTACTCGAGTAATGATCTCCAGGTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1336s21c1
Sequence:CCGGTTAAGCCTGACCACCGAATTGCTCGAGCAATTCGGTGGTCAGGCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-1381s21c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2637s21c1
Sequence:CCGGGTGACCGAGGATAACGTAATGCTCGAGCATTACGTTATCCTCGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010206.2-2115s21c1
Sequence:CCGGCTGGCTGGAGTCTCCGAATATCTCGAGATATTCGGAGACTCCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010206.2-3615s21c1
Sequence:CCGGAGGTTTCTGTTTAGGCCTTAACTCGAGTTAAGGCCTAAACAGAAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-1897s1c1
Sequence:CCGGCTTGCCTCTAAGAAGTGTATACTCGAGTATACACTTCTTAGAGGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010206.1-564s1c1
Sequence:CCGGCGCTGCCAAGACGGTGAAGTTCTCGAGAACTTCACCGTCTTGGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-1953s1c1
Sequence:CCGGCGAGGATAACGTAATGAAGATCTCGAGATCTTCATTACGTTATCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010206.1-692s1c1
Sequence:CCGGCCTGGAGCATCATAATGGATTCTCGAGAATCCATTATGATGCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015850
VALIDATED
FGFR1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-2934s21c1
Sequence:CCGGGATGGCACCCGAGGCATTATTCTCGAGAATAATGCCTCGGGTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1566s21c1
Sequence:CCGGTGCCACCTGGAGCATCATAATCTCGAGATTATGATGCTCCAGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015850.3-3646s21c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1536s21c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-3899s21c1
Sequence:CCGGAGTGGCTTATTAATTCCGATACTCGAGTATCGGAATTAATAAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1880s21c1
Sequence:GTACCGGGAGTTAATACCACCGACAAAGCTCGAGCTTTGTCGGTGGTATTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-3099s1c1
Sequence:CCGGGCCCAGTAACTGCACCAACGACTCGAGTCGTTGGTGCAGTTACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015850.3-5494s1c1
Sequence:CCGGGCTGCAGTGTTGGCGACTATTCTCGAGAATAGTCGCCAACACTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-5174s1c1
Sequence:CCGGCGCAGATCTTGGCTTCTTACACTCGAGTGTAAGAAGCCAAGATCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-5357s1c1
Sequence:CCGGCCACTCCTCAGTCGCTATATTCTCGAGAATATAGCGACTGAGGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-2591s1c1
Sequence:CCGGCGCAGGATGGTCCCTTGTATGCTCGAGCATACAAGGGACCATCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015850
VALIDATED
FGFR1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-2934s21c1
Sequence:CCGGGATGGCACCCGAGGCATTATTCTCGAGAATAATGCCTCGGGTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1566s21c1
Sequence:CCGGTGCCACCTGGAGCATCATAATCTCGAGATTATGATGCTCCAGGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015850.3-3646s21c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1536s21c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-3899s21c1
Sequence:CCGGAGTGGCTTATTAATTCCGATACTCGAGTATCGGAATTAATAAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1880s21c1
Sequence:GTACCGGGAGTTAATACCACCGACAAAGCTCGAGCTTTGTCGGTGGTATTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-3099s1c1
Sequence:CCGGGCCCAGTAACTGCACCAACGACTCGAGTCGTTGGTGCAGTTACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015850.3-5494s1c1
Sequence:CCGGGCTGCAGTGTTGGCGACTATTCTCGAGAATAGTCGCCAACACTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-5174s1c1
Sequence:CCGGCGCAGATCTTGGCTTCTTACACTCGAGTGTAAGAAGCCAAGATCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-5357s1c1
Sequence:CCGGCCACTCCTCAGTCGCTATATTCTCGAGAATATAGCGACTGAGGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-2591s1c1
Sequence:CCGGCGCAGGATGGTCCCTTGTATGCTCGAGCATACAAGGGACCATCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015850
VALIDATED
FGFR1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-2934s21c1
Sequence:CCGGGATGGCACCCGAGGCATTATTCTCGAGAATAATGCCTCGGGTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1566s21c1
Sequence:CCGGTGCCACCTGGAGCATCATAATCTCGAGATTATGATGCTCCAGGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015850.3-3646s21c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1536s21c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-3899s21c1
Sequence:CCGGAGTGGCTTATTAATTCCGATACTCGAGTATCGGAATTAATAAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015850.3-1880s21c1
Sequence:GTACCGGGAGTTAATACCACCGACAAAGCTCGAGCTTTGTCGGTGGTATTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-3099s1c1
Sequence:CCGGGCCCAGTAACTGCACCAACGACTCGAGTCGTTGGTGCAGTTACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015850.3-5494s1c1
Sequence:CCGGGCTGCAGTGTTGGCGACTATTCTCGAGAATAGTCGCCAACACTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-5174s1c1
Sequence:CCGGCGCAGATCTTGGCTTCTTACACTCGAGTGTAAGAAGCCAAGATCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015850.3-5357s1c1
Sequence:CCGGCCACTCCTCAGTCGCTATATTCTCGAGAATATAGCGACTGAGGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015850.3-2591s1c1
Sequence:CCGGCGCAGGATGGTCCCTTGTATGCTCGAGCATACAAGGGACCATCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000604
VALIDATED
FGFR1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-3165s1c1
Sequence:CCGGGCTTGCCAATGGCGGACTCAACTCGAGTTGAGTCCGCCATTGGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1013s1c1
Sequence:CCGGCCGGCCTCTATGCTTGCGTAACTCGAGTTACGCAAGCATAGAGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3436s1c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-1237s1c1
Sequence:CCGGGCCAAGACAGTGAAGTTCAAACTCGAGTTTGAACTTCACTGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1425s1c1
Sequence:CCGGGAATGAGTACGGCAGCATCAACTCGAGTTGATGCTGCCGTACTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3681s1c1
Sequence:CCGGGTGGTGCCAGTGGCTTATTAACTCGAGTTAATAAGCCACTGGCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1668s1c1
Sequence:CCGGTGGAGTTAATACCACCGACAACTCGAGTTGTCGGTGGTATTAACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2340s1c1
Sequence:CCGGCGGGAAGCATAAGAATATCATCTCGAGATGATATTCTTATGCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1326s1c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1917s1c1
Sequence:CCGGCAAGATGAAGAGTGGTACCAACTCGAGTTGGTACCACTCTTCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2394s1c1
Sequence:CCGGCTTGTATGTCATCGTGGAGTACTCGAGTACTCCACGATGACATACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000604.x-3887s1c1
Sequence:CCGGCGTTACCAGAGATTTACCCATCTCGAGATGGGTAAATCTCTGGTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-2463s1c1
Sequence:CCGGAGGGCTGGAATACTGCTACAACTCGAGTTGTAGCAGTATTCCAGCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-1071s1c1
Sequence:CCGGCGTCAATGTTTCAGATGCTCTCTCGAGAGAGCATCTGAAACATTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.x-2733s1c1
Sequence:CCGGCGAGGCATTATTTGACCGGATCTCGAGATCCGGTCAAATAATGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.x-1133s1c1
Sequence:CCGGCAGAGGAGAAAGAAACAGATACTCGAGTATCTGTTTCTTTCTCCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000604
VALIDATED
FGFR1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-3165s1c1
Sequence:CCGGGCTTGCCAATGGCGGACTCAACTCGAGTTGAGTCCGCCATTGGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1013s1c1
Sequence:CCGGCCGGCCTCTATGCTTGCGTAACTCGAGTTACGCAAGCATAGAGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3436s1c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-1237s1c1
Sequence:CCGGGCCAAGACAGTGAAGTTCAAACTCGAGTTTGAACTTCACTGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1425s1c1
Sequence:CCGGGAATGAGTACGGCAGCATCAACTCGAGTTGATGCTGCCGTACTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3681s1c1
Sequence:CCGGGTGGTGCCAGTGGCTTATTAACTCGAGTTAATAAGCCACTGGCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1668s1c1
Sequence:CCGGTGGAGTTAATACCACCGACAACTCGAGTTGTCGGTGGTATTAACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2340s1c1
Sequence:CCGGCGGGAAGCATAAGAATATCATCTCGAGATGATATTCTTATGCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1326s1c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1917s1c1
Sequence:CCGGCAAGATGAAGAGTGGTACCAACTCGAGTTGGTACCACTCTTCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2394s1c1
Sequence:CCGGCTTGTATGTCATCGTGGAGTACTCGAGTACTCCACGATGACATACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000604.x-3887s1c1
Sequence:CCGGCGTTACCAGAGATTTACCCATCTCGAGATGGGTAAATCTCTGGTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-2463s1c1
Sequence:CCGGAGGGCTGGAATACTGCTACAACTCGAGTTGTAGCAGTATTCCAGCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-1071s1c1
Sequence:CCGGCGTCAATGTTTCAGATGCTCTCTCGAGAGAGCATCTGAAACATTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.x-2733s1c1
Sequence:CCGGCGAGGCATTATTTGACCGGATCTCGAGATCCGGTCAAATAATGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.x-1133s1c1
Sequence:CCGGCAGAGGAGAAAGAAACAGATACTCGAGTATCTGTTTCTTTCTCCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000604
VALIDATED
FGFR1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-3165s1c1
Sequence:CCGGGCTTGCCAATGGCGGACTCAACTCGAGTTGAGTCCGCCATTGGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1013s1c1
Sequence:CCGGCCGGCCTCTATGCTTGCGTAACTCGAGTTACGCAAGCATAGAGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3436s1c1
Sequence:CCGGCCCTCCCAGATGTTGGACCAACTCGAGTTGGTCCAACATCTGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-1237s1c1
Sequence:CCGGGCCAAGACAGTGAAGTTCAAACTCGAGTTTGAACTTCACTGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1425s1c1
Sequence:CCGGGAATGAGTACGGCAGCATCAACTCGAGTTGATGCTGCCGTACTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.2-3681s1c1
Sequence:CCGGGTGGTGCCAGTGGCTTATTAACTCGAGTTAATAAGCCACTGGCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1668s1c1
Sequence:CCGGTGGAGTTAATACCACCGACAACTCGAGTTGTCGGTGGTATTAACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2340s1c1
Sequence:CCGGCGGGAAGCATAAGAATATCATCTCGAGATGATATTCTTATGCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.2-1326s1c1
Sequence:CCGGCCACAGAATTGGAGGCTACAACTCGAGTTGTAGCCTCCAATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-1917s1c1
Sequence:CCGGCAAGATGAAGAGTGGTACCAACTCGAGTTGGTACCACTCTTCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.2-2394s1c1
Sequence:CCGGCTTGTATGTCATCGTGGAGTACTCGAGTACTCCACGATGACATACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000604.x-3887s1c1
Sequence:CCGGCGTTACCAGAGATTTACCCATCTCGAGATGGGTAAATCTCTGGTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-2463s1c1
Sequence:CCGGAGGGCTGGAATACTGCTACAACTCGAGTTGTAGCAGTATTCCAGCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000604.x-1071s1c1
Sequence:CCGGCGTCAATGTTTCAGATGCTCTCTCGAGAGAGCATCTGAAACATTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000604.x-2733s1c1
Sequence:CCGGCGAGGCATTATTTGACCGGATCTCGAGATCCGGTCAAATAATGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000604.x-1133s1c1
Sequence:CCGGCAGAGGAGAAAGAAACAGATACTCGAGTATCTGTTTCTTTCTCCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)