EMAIL THIS PAGE TO A FRIEND

FGFRL1

fibroblast growth factor receptor-like 1

76 Gene Product Result for
Synonyms: FGFR5 FHFR
UniProtKB ID: Q8N441, B2RAU9, Q6PJN1, Q9BXN7, Q9H4D7
Gene ID:
Human(53834) Summary: The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(116701) fibroblast growth factor receptor-like 1
Rat(360903) fibroblast growth factor receptor-like 1
naked mole-rat(101724061) fibroblast growth factor receptor-like 1
domestic guinea pig(100720221) fibroblast growth factor receptor-like 1
chicken(395107) fibroblast growth factor receptor-like 1
cow(532327) fibroblast growth factor receptor-like 1
domestic cat(101095654) fibroblast growth factor receptor-like 1
dog(100505382) fibroblast growth factor receptor-like 1
dog(488865) fibroblast growth factor receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004356 Rosetta Predictions human pricing
NM_001004358 Rosetta Predictions human pricing
NM_021923 Rosetta Predictions human pricing
NM_199114 Rosetta Predictions rat pricing
NM_054071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105415 predicted 845
2 SASI_Hs01_00105416 predicted 1098
3 SASI_Hs01_00105417 predicted 633
4 SASI_Hs01_00105418 predicted 871
5 SASI_Hs01_00105419 predicted 1013
6 SASI_Hs01_00105420 predicted 856
7 SASI_Hs01_00105421 predicted 845
8 SASI_Hs01_00105422 predicted 1038
9 SASI_Hs01_00105423 predicted 840
10 SASI_Hs01_00105424 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246706 predicted 722
2 SASI_Hs01_00246707 predicted 972
3 SASI_Hs01_00246708 predicted 517
4 SASI_Hs01_00246709 predicted 757
5 SASI_Hs01_00246710 predicted 903
6 SASI_Hs01_00246711 predicted 736
7 SASI_Hs01_00246712 predicted 726
8 SASI_Hs01_00246713 predicted 921
9 SASI_Hs01_00246714 predicted 717
10 SASI_Hs01_00246715 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167536 predicted 719
2 SASI_Hs01_00167537 predicted 970
3 SASI_Hs01_00167538 predicted 512
4 SASI_Hs01_00167539 predicted 742
5 SASI_Hs01_00167540 predicted 887
6 SASI_Hs01_00167541 predicted 731
7 SASI_Hs01_00167542 predicted 717
8 SASI_Hs01_00167543 predicted 916
9 SASI_Hs01_00167544 predicted 711
10 SASI_Hs01_00167545 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107705 predicted 1139
2 SASI_Rn01_00107707 predicted 1819
3 SASI_Rn01_00107708 predicted 776
4 SASI_Rn02_00270138 predicted 1813
5 SASI_Rn01_00107709 predicted 824
6 SASI_Rn01_00107710 predicted 961
7 SASI_Rn01_00107711 predicted 415
8 SASI_Rn01_00107713 predicted 582
9 SASI_Rn01_00107714 predicted 765
10 SASI_Rn02_00270139 predicted 834
11 SASI_Rn01_00107706 predicted 471
12 SASI_Rn01_00107712 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153359 predicted 361
2 SASI_Mm01_00153360 predicted 1054
3 SASI_Mm01_00153361 predicted 1190
4 SASI_Mm02_00337997 predicted 714
5 SASI_Mm01_00153362 predicted 758
6 SASI_Mm01_00153363 predicted 871
7 SASI_Mm01_00153364 predicted 819
8 SASI_Mm01_00153366 predicted 460
9 SASI_Mm01_00153367 predicted 1852
10 SASI_Mm01_00153368 predicted 807
11 SASI_Mm01_00153365 predicted 1845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004356
VALIDATED
FGFRL1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2158s21c1
Sequence:CCGGCACACACATGCACGGATATTGCTCGAGCAATATCCGTGCATGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-490s21c1
Sequence:CCGGTCGTCGTGCTGGATGACATTACTCGAGTAATGTCATCCAGCACGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2076s21c1
Sequence:CCGGGACGCACACACGTGCAGATATCTCGAGATATCTGCACGTGTGTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-1094s21c1
Sequence:CCGGCGACGGCTCCTACCTCAATAACTCGAGTTATTGAGGTAGGAGCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1643s1c1
Sequence:CCGGGCACATCCACTATCAGTGCTACTCGAGTAGCACTGATAGTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004356.1-2412s1c1
Sequence:CCGGCCTGGACACACACACAGATAACTCGAGTTATCTGTGTGTGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-908s1c1
Sequence:CCGGCGTGAACACGACGGTGGACTTCTCGAGAAGTCCACCGTCGTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001004356.1-686s1c1
Sequence:CCGGGCCCGACATCACGTGGATGAACTCGAGTTCATCCACGTGATGTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1103s1c1
Sequence:CCGGCTACCTCAATAAGCTGCTCATCTCGAGATGAGCAGCTTATTGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004356
VALIDATED
FGFRL1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2158s21c1
Sequence:CCGGCACACACATGCACGGATATTGCTCGAGCAATATCCGTGCATGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-490s21c1
Sequence:CCGGTCGTCGTGCTGGATGACATTACTCGAGTAATGTCATCCAGCACGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2076s21c1
Sequence:CCGGGACGCACACACGTGCAGATATCTCGAGATATCTGCACGTGTGTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-1094s21c1
Sequence:CCGGCGACGGCTCCTACCTCAATAACTCGAGTTATTGAGGTAGGAGCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1643s1c1
Sequence:CCGGGCACATCCACTATCAGTGCTACTCGAGTAGCACTGATAGTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004356.1-2412s1c1
Sequence:CCGGCCTGGACACACACACAGATAACTCGAGTTATCTGTGTGTGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-908s1c1
Sequence:CCGGCGTGAACACGACGGTGGACTTCTCGAGAAGTCCACCGTCGTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001004356.1-686s1c1
Sequence:CCGGGCCCGACATCACGTGGATGAACTCGAGTTCATCCACGTGATGTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1103s1c1
Sequence:CCGGCTACCTCAATAAGCTGCTCATCTCGAGATGAGCAGCTTATTGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004356
VALIDATED
FGFRL1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2158s21c1
Sequence:CCGGCACACACATGCACGGATATTGCTCGAGCAATATCCGTGCATGTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-490s21c1
Sequence:CCGGTCGTCGTGCTGGATGACATTACTCGAGTAATGTCATCCAGCACGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004356.2-2076s21c1
Sequence:CCGGGACGCACACACGTGCAGATATCTCGAGATATCTGCACGTGTGTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004356.2-1094s21c1
Sequence:CCGGCGACGGCTCCTACCTCAATAACTCGAGTTATTGAGGTAGGAGCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1643s1c1
Sequence:CCGGGCACATCCACTATCAGTGCTACTCGAGTAGCACTGATAGTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004356.1-2412s1c1
Sequence:CCGGCCTGGACACACACACAGATAACTCGAGTTATCTGTGTGTGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-908s1c1
Sequence:CCGGCGTGAACACGACGGTGGACTTCTCGAGAAGTCCACCGTCGTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001004356.1-686s1c1
Sequence:CCGGGCCCGACATCACGTGGATGAACTCGAGTTCATCCACGTGATGTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004356.1-1103s1c1
Sequence:CCGGCTACCTCAATAAGCTGCTCATCTCGAGATGAGCAGCTTATTGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054071
VALIDATED
FGFRL1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-516s1c1
Sequence:CCGGCTCATCATCATGGATGATATTCTCGAGAATATCATCCATGATGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1809s1c1
Sequence:CCGGGCCATATAGATGTATGTACTACTCGAGTAGTACATACATCTATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054071.1-871s1c1
Sequence:CCGGCCACCTACAAAGTGGATGTAACTCGAGTTACATCCACTTTGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1662s1c1
Sequence:CCGGTGTCCACTATCAGTGCTAAATCTCGAGATTTAGCACTGATAGTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-713s1c1
Sequence:CCGGGCCAGACATCATGTGGATGAACTCGAGTTCATCCACATGATGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054071
VALIDATED
FGFRL1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-516s1c1
Sequence:CCGGCTCATCATCATGGATGATATTCTCGAGAATATCATCCATGATGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1809s1c1
Sequence:CCGGGCCATATAGATGTATGTACTACTCGAGTAGTACATACATCTATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054071.1-871s1c1
Sequence:CCGGCCACCTACAAAGTGGATGTAACTCGAGTTACATCCACTTTGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1662s1c1
Sequence:CCGGTGTCCACTATCAGTGCTAAATCTCGAGATTTAGCACTGATAGTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-713s1c1
Sequence:CCGGGCCAGACATCATGTGGATGAACTCGAGTTCATCCACATGATGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054071
VALIDATED
FGFRL1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-516s1c1
Sequence:CCGGCTCATCATCATGGATGATATTCTCGAGAATATCATCCATGATGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1809s1c1
Sequence:CCGGGCCATATAGATGTATGTACTACTCGAGTAGTACATACATCTATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054071.1-871s1c1
Sequence:CCGGCCACCTACAAAGTGGATGTAACTCGAGTTACATCCACTTTGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-1662s1c1
Sequence:CCGGTGTCCACTATCAGTGCTAAATCTCGAGATTTAGCACTGATAGTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054071.1-713s1c1
Sequence:CCGGGCCAGACATCATGTGGATGAACTCGAGTTCATCCACATGATGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)