EMAIL THIS PAGE TO A FRIEND

FHOD1

formin homology 2 domain containing 1

59 Gene Product Result for
Synonyms: FHOS
UniProtKB ID: Q9Y613, Q59F76, Q6Y1F2, Q76MS8, Q8N521
Gene ID:
Human(29109) Summary: This gene encodes a protein which is a member of the formin/diaphanous family of proteins. The gene is ubiquitously expressed but is found in abundance in the spleen. The encoded protein has sequence homology to diaphanous and formin proteins within the Formin Homology (FH)1 and FH2 domains. It also contains a coiled-coil domain, a collagen-like domain, two nuclear localization signals, and several potential PKC and PKA phosphorylation sites. It is a predominantly cytoplasmic protein and is expressed in a variety of human cell lines. [provided by RefSeq, Jul 2008]
Mouse(234686) formin homology 2 domain containing 1
Rat(291964) formin homology 2 domain containing 1
Zebrafish(503946) formin homology 2 domain containing 1
chicken(415672) formin homology 2 domain containing 1
dog(489760) formin homology 2 domain containing 1
cow(787862) formin homology 2 domain containing 1
Horse(100053166) formin homology 2 domain containing 1
Domestic Rabbit(100349142) formin homology 2 domain containing 1
naked mole-rat(101714950) formin homology 2 domain containing 1
domestic guinea pig(100734263) formin homology 2 domain containing 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023121 MISSION® esiRNA esiRNA human FHOD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013241 Rosetta Predictions human pricing
XM_001072430 Rosetta Predictions rat pricing
XM_214682 Rosetta Predictions rat pricing
NM_177699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202297 predicted 2526
2 SASI_Hs01_00202298 predicted 3110
3 SASI_Hs01_00202299 predicted 2464
4 SASI_Hs01_00202300 predicted 1459
5 SASI_Hs01_00202301 predicted 1350
6 SASI_Hs01_00202302 predicted 3396
7 SASI_Hs01_00202303 predicted 343
8 SASI_Hs01_00202304 predicted 317
9 SASI_Hs01_00202305 predicted 2265
10 SASI_Hs01_00202306 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339133 predicted 2699
2 SASI_Rn02_00339134 predicted 3087
3 SASI_Rn02_00339135 predicted 1538
4 SASI_Rn02_00339136 predicted 2383
5 SASI_Rn02_00339137 predicted 3044
6 SASI_Rn02_00339138 predicted 1406
7 SASI_Rn02_00339139 predicted 920
8 SASI_Rn02_00339140 predicted 976
9 SASI_Rn02_00339141 predicted 2093
10 SASI_Rn02_00339142 predicted 2241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375505 predicted 2697
2 SASI_Rn02_00375506 predicted 3085
3 SASI_Rn02_00375507 predicted 1539
4 SASI_Rn02_00375508 predicted 2378
5 SASI_Rn02_00375509 predicted 3043
6 SASI_Rn02_00375510 predicted 1397
7 SASI_Rn02_00375511 predicted 926
8 SASI_Rn02_00375512 predicted 979
9 SASI_Rn02_00375513 predicted 2093
10 SASI_Rn02_00375514 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164555 predicted 2783
2 SASI_Mm01_00164556 predicted 3129
3 SASI_Mm01_00164557 predicted 2469
4 SASI_Mm01_00164558 predicted 2625
5 SASI_Mm01_00164559 predicted 3168
6 SASI_Mm01_00164560 predicted 2778
7 SASI_Mm01_00164561 predicted 2355
8 SASI_Mm01_00164562 predicted 2173
9 SASI_Mm01_00164564 predicted 3173
10 SASI_Mm02_00348046 predicted 694
11 SASI_Mm01_00164563 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013241
VALIDATED
FHOD1 MISSION shRNA Bacterial Glycerol Stock
formin homology 2 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-705s21c1
Sequence:CCGGTGGCCCACAGTGACACTATTCCTCGAGGAATAGTGTCACTGTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2483s21c1
Sequence:CCGGGACAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-1098s21c1
Sequence:CCGGTCTACGAGAACGCCCTGAAATCTCGAGATTTCAGGGCGTTCTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2728s21c1
Sequence:CCGGTGAGTCCTCTGACCTCTATTCCTCGAGGAATAGAGGTCAGAGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-3608s21c1
Sequence:CCGGAGGTGCTGTATCCCGGAAATCCTCGAGGATTTCCGGGATACAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-477s1c1
Sequence:CCGGGCCTGAATTTGTGCATTCAGACTCGAGTCTGAATGCACAAATTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013241.1-3529s1c1
Sequence:CCGGGAAATCTATCTGGACCCTGGACTCGAGTCCAGGGTCCAGATAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-2404s1c1
Sequence:CCGGGAAATTGCTGAGCCACTGTTTCTCGAGAAACAGTGGCTCAGCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013241
VALIDATED
FHOD1 MISSION shRNA shRNA Plasmid DNA
formin homology 2 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-705s21c1
Sequence:CCGGTGGCCCACAGTGACACTATTCCTCGAGGAATAGTGTCACTGTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2483s21c1
Sequence:CCGGGACAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-1098s21c1
Sequence:CCGGTCTACGAGAACGCCCTGAAATCTCGAGATTTCAGGGCGTTCTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2728s21c1
Sequence:CCGGTGAGTCCTCTGACCTCTATTCCTCGAGGAATAGAGGTCAGAGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-3608s21c1
Sequence:CCGGAGGTGCTGTATCCCGGAAATCCTCGAGGATTTCCGGGATACAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-477s1c1
Sequence:CCGGGCCTGAATTTGTGCATTCAGACTCGAGTCTGAATGCACAAATTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013241.1-3529s1c1
Sequence:CCGGGAAATCTATCTGGACCCTGGACTCGAGTCCAGGGTCCAGATAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-2404s1c1
Sequence:CCGGGAAATTGCTGAGCCACTGTTTCTCGAGAAACAGTGGCTCAGCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013241
VALIDATED
FHOD1 MISSION shRNA Lentiviral Transduction Particles
formin homology 2 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-705s21c1
Sequence:CCGGTGGCCCACAGTGACACTATTCCTCGAGGAATAGTGTCACTGTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2483s21c1
Sequence:CCGGGACAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013241.2-1098s21c1
Sequence:CCGGTCTACGAGAACGCCCTGAAATCTCGAGATTTCAGGGCGTTCTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-2728s21c1
Sequence:CCGGTGAGTCCTCTGACCTCTATTCCTCGAGGAATAGAGGTCAGAGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013241.2-3608s21c1
Sequence:CCGGAGGTGCTGTATCCCGGAAATCCTCGAGGATTTCCGGGATACAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-477s1c1
Sequence:CCGGGCCTGAATTTGTGCATTCAGACTCGAGTCTGAATGCACAAATTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013241.1-3529s1c1
Sequence:CCGGGAAATCTATCTGGACCCTGGACTCGAGTCCAGGGTCCAGATAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013241.1-2404s1c1
Sequence:CCGGGAAATTGCTGAGCCACTGTTTCTCGAGAAACAGTGGCTCAGCAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177699
FHOD1 MISSION shRNA Bacterial Glycerol Stock
formin homology 2 domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177699.3-3686s21c1
Sequence:CCGGCTGGACATGACAGCGACATACCTCGAGGTATGTCGCTGTCATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-486s21c1
Sequence:CCGGCCGATCTCTCTTCTCATTAAACTCGAGTTTAATGAGAAGAGAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-2545s21c1
Sequence:CCGGGAAAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.3-1344s1c1
Sequence:CCGGGAACCTCTTTCCTACCATTTCCTCGAGGAAATGGTAGGAAAGAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-3200s21c1
Sequence:CCGGAGACCCGTGGTCGCATGATTACTCGAGTAATCATGCGACCACGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-1343s21c1
Sequence:CCGGTGAACCTCTTTCCTACCATTTCTCGAGAAATGGTAGGAAAGAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177699.2-3732s1c1
Sequence:CCGGCCTGGAACAGAAACCTGGTTTCTCGAGAAACCAGGTTTCTGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.2-2996s1c1
Sequence:CCGGGCCATGTTAAGAGTAGTGCATCTCGAGATGCACTACTCTTAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177699
FHOD1 MISSION shRNA shRNA Plasmid DNA
formin homology 2 domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177699.3-3686s21c1
Sequence:CCGGCTGGACATGACAGCGACATACCTCGAGGTATGTCGCTGTCATGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-486s21c1
Sequence:CCGGCCGATCTCTCTTCTCATTAAACTCGAGTTTAATGAGAAGAGAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-2545s21c1
Sequence:CCGGGAAAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.3-1344s1c1
Sequence:CCGGGAACCTCTTTCCTACCATTTCCTCGAGGAAATGGTAGGAAAGAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-3200s21c1
Sequence:CCGGAGACCCGTGGTCGCATGATTACTCGAGTAATCATGCGACCACGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-1343s21c1
Sequence:CCGGTGAACCTCTTTCCTACCATTTCTCGAGAAATGGTAGGAAAGAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177699.2-3732s1c1
Sequence:CCGGCCTGGAACAGAAACCTGGTTTCTCGAGAAACCAGGTTTCTGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.2-2996s1c1
Sequence:CCGGGCCATGTTAAGAGTAGTGCATCTCGAGATGCACTACTCTTAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177699
FHOD1 MISSION shRNA Lentiviral Transduction Particles
formin homology 2 domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177699.3-3686s21c1
Sequence:CCGGCTGGACATGACAGCGACATACCTCGAGGTATGTCGCTGTCATGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-486s21c1
Sequence:CCGGCCGATCTCTCTTCTCATTAAACTCGAGTTTAATGAGAAGAGAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-2545s21c1
Sequence:CCGGGAAAGCATGGAGCGGGAAATTCTCGAGAATTTCCCGCTCCATGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.3-1344s1c1
Sequence:CCGGGAACCTCTTTCCTACCATTTCCTCGAGGAAATGGTAGGAAAGAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-3200s21c1
Sequence:CCGGAGACCCGTGGTCGCATGATTACTCGAGTAATCATGCGACCACGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177699.3-1343s21c1
Sequence:CCGGTGAACCTCTTTCCTACCATTTCTCGAGAAATGGTAGGAAAGAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177699.2-3732s1c1
Sequence:CCGGCCTGGAACAGAAACCTGGTTTCTCGAGAAACCAGGTTTCTGTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177699.2-2996s1c1
Sequence:CCGGGCCATGTTAAGAGTAGTGCATCTCGAGATGCACTACTCTTAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)