EMAIL THIS PAGE TO A FRIEND

FIG4

FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)

72 Gene Product Result for
Synonyms: ALS11 CMT4J KIAA0274 SAC3 YVS dJ249I4.1
UniProtKB ID: Q92562, Q53H49, Q5TCS6
Gene ID:
Human(9896) Summary: The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
Mouse(103199) FIG4 homolog (S. cerevisiae)
Rat(309855) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Zebrafish(100329711) FIG4 homolog
cow(534118) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Horse(100066727) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
domestic cat(101080288) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
dog(475023) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
chicken(421762) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Zebrafish(100334605) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
naked mole-rat(101713458) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
sheep(101113245) FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302641 ANTI-FIG4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB2700074 Anti-FIG4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA068859 Anti-FIG4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB5201563 Monoclonal Anti-Fig4/Sac3 - Alkaline Phosphatase antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201564 Monoclonal Anti-Fig4/Sac3 - Apc antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201555 Monoclonal Anti-Fig4/Sac3 - Atto 390 antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201556 Monoclonal Anti-Fig4/Sac3 - Atto 488 antibody produced in mouse clone S202-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201557 Monoclonal Anti-Fig4/Sac3 - Atto 565 antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201558 Monoclonal Anti-Fig4/Sac3 - Atto 594 antibody produced in mouse clone S202-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201559 Monoclonal Anti-Fig4/Sac3 - Atto 633 antibody produced in mouse clone S202-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201560 Monoclonal Anti-Fig4/Sac3 - Atto 655 antibody produced in mouse clone S202-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201561 Monoclonal Anti-Fig4/Sac3 - Atto 680 antibody produced in mouse clone S202-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201562 Monoclonal Anti-Fig4/Sac3 - Atto 700 antibody produced in mouse clone S202-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201565 Monoclonal Anti-Fig4/Sac3 - Biotin antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201566 Monoclonal Anti-Fig4/Sac3 - Fitc antibody produced in mouse clone S202-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201567 Monoclonal Anti-Fig4/Sac3 - Hrp antibody produced in mouse clone S202-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201568 Monoclonal Anti-Fig4/Sac3 - Pe/Atto 594 antibody produced in mouse clone S202-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201569 Monoclonal Anti-Fig4/Sac3 - Percp antibody produced in mouse clone S202-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201570 Monoclonal Anti-Fig4/Sac3 - Rpe antibody produced in mouse clone S202-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201571 Monoclonal Anti-Fig4/Sac3 - Streptavidin antibody produced in mouse clone S202-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201554 Monoclonal Anti-Fig4/Sac3 antibody produced in mouse clone S202-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033871 MISSION® esiRNA esiRNA targeting mouse Fig4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014845 Rosetta Predictions human pricing
NM_001047096 Rosetta Predictions rat pricing
NM_133999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064500 predicted 1895
2 SASI_Hs01_00064501 predicted 575
3 SASI_Hs01_00064502 predicted 2038
4 SASI_Hs02_00346403 predicted 2536
5 SASI_Hs01_00064503 predicted 1149
6 SASI_Hs01_00064504 predicted 536
7 SASI_Hs02_00346404 predicted 2596
8 SASI_Hs02_00346405 predicted 1754
9 SASI_Hs01_00064505 predicted 1450
10 SASI_Hs01_00064506 predicted 255
11 SASI_Hs01_00064507 predicted 1569
12 SASI_Hs01_00064508 predicted 606
13 SASI_Hs01_00064509 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205894 predicted 1355
2 SASI_Rn02_00205895 predicted 607
3 SASI_Rn02_00205896 predicted 1582
4 SASI_Rn02_00205897 predicted 1251
5 SASI_Rn02_00205898 predicted 317
6 SASI_Rn02_00205899 predicted 946
7 SASI_Rn02_00205900 predicted 1514
8 SASI_Rn02_00205901 predicted 2549
9 SASI_Rn02_00205902 predicted 442
10 SASI_Rn02_00205903 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146270 predicted 1539
2 SASI_Mm01_00146271 predicted 1910
3 SASI_Mm02_00339141 predicted 1770
4 SASI_Mm01_00146273 predicted 1989
5 SASI_Mm01_00146274 predicted 1437
6 SASI_Mm01_00146275 predicted 1711
7 SASI_Mm01_00146276 predicted 422
8 SASI_Mm01_00146278 predicted 2301
9 SASI_Mm01_00146279 predicted 2734
10 SASI_Mm02_00339142 predicted 1172
11 SASI_Mm01_00146272 predicted 505
12 SASI_Mm01_00146277 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014845
VALIDATED
FIG4 MISSION shRNA Bacterial Glycerol Stock
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-2938s1c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-1925s1c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-967s1c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-538s1c1
Sequence:CCGGGCAATCTATAAGGTCGAAGATCTCGAGATCTTCGACCTTATAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-964s1c1
Sequence:CCGGCGACCAGTGTATGTCACTCTACTCGAGTAGAGTGACATACACTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-513s21c1
Sequence:CCGGAGGTTCTTAGAAGGCTATTATCTCGAGATAATAGCCTTCTAAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1011s21c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-2982s21c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1969s21c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-656s21c1
Sequence:CCGGAGCTAGGTATCTACGAATATTCTCGAGAATATTCGTAGATACCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014845
VALIDATED
FIG4 MISSION shRNA shRNA Plasmid DNA
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-2938s1c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-1925s1c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-967s1c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-538s1c1
Sequence:CCGGGCAATCTATAAGGTCGAAGATCTCGAGATCTTCGACCTTATAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-964s1c1
Sequence:CCGGCGACCAGTGTATGTCACTCTACTCGAGTAGAGTGACATACACTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-513s21c1
Sequence:CCGGAGGTTCTTAGAAGGCTATTATCTCGAGATAATAGCCTTCTAAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1011s21c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-2982s21c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1969s21c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-656s21c1
Sequence:CCGGAGCTAGGTATCTACGAATATTCTCGAGAATATTCGTAGATACCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014845
VALIDATED
FIG4 MISSION shRNA Lentiviral Transduction Particles
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-2938s1c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-1925s1c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-967s1c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-538s1c1
Sequence:CCGGGCAATCTATAAGGTCGAAGATCTCGAGATCTTCGACCTTATAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014845.4-964s1c1
Sequence:CCGGCGACCAGTGTATGTCACTCTACTCGAGTAGAGTGACATACACTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-513s21c1
Sequence:CCGGAGGTTCTTAGAAGGCTATTATCTCGAGATAATAGCCTTCTAAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1011s21c1
Sequence:CCGGCCAGTGTATGTCACTCTAATACTCGAGTATTAGAGTGACATACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-2982s21c1
Sequence:CCGGGAACCTGTCTTGTCTCATCTTCTCGAGAAGATGAGACAAGACAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-1969s21c1
Sequence:CCGGCCGATAGACAAGATTCCATTACTCGAGTAATGGAATCTTGTCTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014845.5-656s21c1
Sequence:CCGGAGCTAGGTATCTACGAATATTCTCGAGAATATTCGTAGATACCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133999
VALIDATED
FIG4 MISSION shRNA Bacterial Glycerol Stock
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-3029s1c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2226s1c1
Sequence:CCGGGCCGTATGAATTGAGTAGTTTCTCGAGAAACTACTCAATTCATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-1131s1c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2121s1c1
Sequence:CCGGGCTGCCTTACGATGAAGTTATCTCGAGATAACTTCATCGTAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-985s1c1
Sequence:CCGGCCAGTGTATGTGACCCTAATACTCGAGTATTAGGGTCACATACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-882s21c1
Sequence:CCGGCGGTGAACTTCTGGATATAATCTCGAGATTATATCCAGAAGTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-1131s21c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133999.1-3029s21c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-2309s21c1
Sequence:CCGGGCATTGATCCAAGTCCATTTACTCGAGTAAATGGACTTGGATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-544s21c1
Sequence:CCGGATTGGAGGTCATGCAATTTATCTCGAGATAAATTGCATGACCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133999
VALIDATED
FIG4 MISSION shRNA shRNA Plasmid DNA
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-3029s1c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2226s1c1
Sequence:CCGGGCCGTATGAATTGAGTAGTTTCTCGAGAAACTACTCAATTCATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-1131s1c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2121s1c1
Sequence:CCGGGCTGCCTTACGATGAAGTTATCTCGAGATAACTTCATCGTAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-985s1c1
Sequence:CCGGCCAGTGTATGTGACCCTAATACTCGAGTATTAGGGTCACATACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-882s21c1
Sequence:CCGGCGGTGAACTTCTGGATATAATCTCGAGATTATATCCAGAAGTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-1131s21c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133999.1-3029s21c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-2309s21c1
Sequence:CCGGGCATTGATCCAAGTCCATTTACTCGAGTAAATGGACTTGGATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-544s21c1
Sequence:CCGGATTGGAGGTCATGCAATTTATCTCGAGATAAATTGCATGACCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133999
VALIDATED
FIG4 MISSION shRNA Lentiviral Transduction Particles
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-3029s1c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2226s1c1
Sequence:CCGGGCCGTATGAATTGAGTAGTTTCTCGAGAAACTACTCAATTCATACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-1131s1c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133999.1-2121s1c1
Sequence:CCGGGCTGCCTTACGATGAAGTTATCTCGAGATAACTTCATCGTAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133999.1-985s1c1
Sequence:CCGGCCAGTGTATGTGACCCTAATACTCGAGTATTAGGGTCACATACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-882s21c1
Sequence:CCGGCGGTGAACTTCTGGATATAATCTCGAGATTATATCCAGAAGTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-1131s21c1
Sequence:CCGGCGCAGGCAGTTACTCTTCTTACTCGAGTAAGAAGAGTAACTGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133999.1-3029s21c1
Sequence:CCGGCCAGGAATCCAGTGTTGTCTTCTCGAGAAGACAACACTGGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-2309s21c1
Sequence:CCGGGCATTGATCCAAGTCCATTTACTCGAGTAAATGGACTTGGATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133999.1-544s21c1
Sequence:CCGGATTGGAGGTCATGCAATTTATCTCGAGATAAATTGCATGACCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)