EMAIL THIS PAGE TO A FRIEND

FIS1

fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)

52 Gene Product Result for
Synonyms: TTC11
UniProtKB ID: Q9Y3D6, Q9BTP3
Gene ID:
Human(51024) Summary: The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]
Mouse(66437) fission 1 (mitochondrial outer membrane) homolog (yeast)
Rat(288584) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
fruit fly(49892) CG17510 gene product from transcript CG17510-RA
domestic cat(101081944) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
dog(479728) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
cow(615565) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
naked mole-rat(101700353) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
domestic guinea pig(100715980) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Goat(100861340) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
sheep(101118583) fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017430 Anti-FIS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702049 Anti-FIS1 antibody produced in rabbit human, mouse, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
WH0051024M1 Monoclonal Anti-FIS1 antibody produced in mouse clone 1G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405076 Monoclonal Anti-FIS1 antibody produced in mouse clone 1G9, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016068 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016691 MISSION® esiRNA esiRNA targeting mouse Fis1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016068 Rosetta Predictions human pricing
NM_001105919 Rosetta Predictions rat pricing
NM_025562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171949 predicted 281
2 SASI_Hs01_00171952 predicted 398
3 SASI_Hs01_00171953 predicted 504
4 SASI_Hs01_00171955 predicted 449
5 SASI_Hs02_00348807 predicted 225
6 SASI_Hs01_00171956 predicted 245
7 SASI_Hs01_00171951 predicted 218
8 SASI_Hs01_00171957 predicted 279
9 SASI_Hs01_00171958 predicted 278
10 SASI_Hs02_00348808 predicted 406
11 SASI_Hs01_00171950 predicted 513
12 SASI_Hs01_00171954 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213832 predicted 703
2 SASI_Rn02_00213833 predicted 380
3 SASI_Rn02_00213834 predicted 462
4 SASI_Rn02_00213835 predicted 474
5 SASI_Rn02_00213836 predicted 499
6 SASI_Rn02_00213837 predicted 581
7 SASI_Rn02_00213838 predicted 504
8 SASI_Rn02_00213839 predicted 350
9 SASI_Rn02_00213840 predicted 401
10 SASI_Rn02_00213841 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022626 predicted 408
2 SASI_Mm01_00022627 predicted 309
3 SASI_Mm01_00022628 predicted 297
4 SASI_Mm01_00022629 predicted 424
5 SASI_Mm01_00022630 predicted 328
6 SASI_Mm01_00022631 predicted 336
7 SASI_Mm01_00022633 predicted 418
8 SASI_Mm02_00328526 predicted 299
9 SASI_Mm02_00328527 predicted 285
10 SASI_Mm02_00328528 predicted 356
11 SASI_Mm01_00022625 predicted 220
12 SASI_Mm01_00022632 predicted 241
13 SASI_Mm01_00022634 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025562
VALIDATED
FIS1 MISSION shRNA Bacterial Glycerol Stock
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-542s21c1
Sequence:CCGGGGCTGTCTCCAAGTCCAAATCCTCGAGGATTTGGACTTGGAGACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-443s21c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-194s21c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-230s21c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-435s1c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-344s1c1
Sequence:CCGGACCGGCTCAAGGAATATGAAACTCGAGTTTCATATTCCTTGAGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-200s1c1
Sequence:CCGGCGCAATTTGAATATGCCTGGTCTCGAGACCAGGCATATTCAAATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-222s1c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-186s1c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025562
VALIDATED
FIS1 MISSION shRNA shRNA Plasmid DNA
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-542s21c1
Sequence:CCGGGGCTGTCTCCAAGTCCAAATCCTCGAGGATTTGGACTTGGAGACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-443s21c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-194s21c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-230s21c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-435s1c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-344s1c1
Sequence:CCGGACCGGCTCAAGGAATATGAAACTCGAGTTTCATATTCCTTGAGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-200s1c1
Sequence:CCGGCGCAATTTGAATATGCCTGGTCTCGAGACCAGGCATATTCAAATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-222s1c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-186s1c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025562
VALIDATED
FIS1 MISSION shRNA Lentiviral Transduction Particles
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-542s21c1
Sequence:CCGGGGCTGTCTCCAAGTCCAAATCCTCGAGGATTTGGACTTGGAGACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-443s21c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-194s21c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025562.3-230s21c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-435s1c1
Sequence:CCGGCCTGATTGATAAGGCCATGAACTCGAGTTCATGGCCTTATCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-344s1c1
Sequence:CCGGACCGGCTCAAGGAATATGAAACTCGAGTTTCATATTCCTTGAGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-200s1c1
Sequence:CCGGCGCAATTTGAATATGCCTGGTCTCGAGACCAGGCATATTCAAATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-222s1c1
Sequence:CCGGCCTGGTTCGAAGCAAATACAACTCGAGTTGTATTTGCTTCGAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025562.1-186s1c1
Sequence:CCGGTGTGTCCAAGAGCACGCAATTCTCGAGAATTGCGTGCTCTTGGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016068
VALIDATED
FIS1 MISSION shRNA Bacterial Glycerol Stock
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-224s21c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-179s21c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-422s21c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-326s21c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-174s1c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-417s1c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-219s1c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-321s1c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016068.1-115s1c1
Sequence:CCGGGAGGACCTGCTGAAGTTTGAACTCGAGTTCAAACTTCAGCAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016068.1-210s1c1
Sequence:CCGGGCGGACAAGGTACAATGATGACTCGAGTCATCATTGTACCTTGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016068
VALIDATED
FIS1 MISSION shRNA shRNA Plasmid DNA
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-224s21c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-179s21c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-422s21c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-326s21c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-174s1c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-417s1c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-219s1c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-321s1c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016068.1-115s1c1
Sequence:CCGGGAGGACCTGCTGAAGTTTGAACTCGAGTTCAAACTTCAGCAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016068.1-210s1c1
Sequence:CCGGGCGGACAAGGTACAATGATGACTCGAGTCATCATTGTACCTTGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016068
VALIDATED
FIS1 MISSION shRNA Lentiviral Transduction Particles
fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-224s21c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-179s21c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-422s21c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016068.2-326s21c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-174s1c1
Sequence:CCGGCAAGAGCACGCAGTTTGAGTACTCGAGTACTCAAACTGCGTGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-417s1c1
Sequence:CCGGGCTCATTGACAAGGCCATGAACTCGAGTTCATGGCCTTGTCAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-219s1c1
Sequence:CCGGGTACAATGATGACATCCGTAACTCGAGTTACGGATGTCATCATTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016068.1-321s1c1
Sequence:CCGGGAACTACCGGCTCAAGGAATACTCGAGTATTCCTTGAGCCGGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016068.1-115s1c1
Sequence:CCGGGAGGACCTGCTGAAGTTTGAACTCGAGTTCAAACTTCAGCAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016068.1-210s1c1
Sequence:CCGGGCGGACAAGGTACAATGATGACTCGAGTCATCATTGTACCTTGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)