EMAIL THIS PAGE TO A FRIEND

FKBP11

FK506 binding protein 11, 19 kDa

101 Gene Product Result for
Synonyms: FKBP19
UniProtKB ID: Q9NYL4, B4DWB7
Gene ID:
Human(51303) Summary: FKBP11 belongs to the FKBP family of peptidyl-prolyl cis/trans isomerases, which catalyze the folding of proline-containing polypeptides. The peptidyl-prolyl isomerase activity of FKBP proteins is inhibited by the immunosuppressant compounds FK506 and rapamycin (Rulten et al., 2006 [PubMed 16596453]
Mouse(66120) FK506 binding protein 11
Rat(300211) FK506 binding protein 11
Zebrafish(368823) FK506 binding protein 11
cow(506043) FK506 binding protein 11, 19 kDa
domestic cat(101093115) FK506 binding protein 11, 19 kDa
dog(608951) FK506 binding protein 11, 19 kDa
naked mole-rat(101724268) FK506 binding protein 11, 19 kDa
domestic guinea pig(100729476) FK506 binding protein 11, 19 kDa
sheep(101103798) FK506 binding protein 11, 19 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016594 Rosetta Predictions human pricing
NM_001013105 Rosetta Predictions rat pricing
NM_024169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239353 predicted 400
2 SASI_Hs01_00239354 predicted 399
3 SASI_Hs01_00239355 predicted 361
4 SASI_Hs01_00239357 predicted 395
5 SASI_Hs01_00239358 predicted 346
6 SASI_Hs01_00239359 predicted 407
7 SASI_Hs01_00239360 predicted 385
8 SASI_Hs01_00239361 predicted 353
9 SASI_Hs01_00239362 predicted 386
10 SASI_Hs02_00349726 predicted 410
11 SASI_Hs01_00239356 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055219 predicted 344
2 SASI_Rn01_00055221 predicted 643
3 SASI_Rn01_00055222 predicted 302
4 SASI_Rn01_00055223 predicted 786
5 SASI_Rn01_00055224 predicted 502
6 SASI_Rn01_00055225 predicted 710
7 SASI_Rn01_00055226 predicted 828
8 SASI_Rn01_00055227 predicted 337
9 SASI_Rn01_00055228 predicted 398
10 SASI_Rn02_00200779 predicted 392
11 SASI_Rn01_00055220 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062353 predicted 280
2 SASI_Mm01_00062354 predicted 325
3 SASI_Mm01_00062355 predicted 344
4 SASI_Mm01_00062356 predicted 359
5 SASI_Mm01_00062357 predicted 496
6 SASI_Mm01_00062359 predicted 337
7 SASI_Mm01_00062360 predicted 479
8 SASI_Mm01_00062362 predicted 264
9 SASI_Mm02_00327472 predicted 306
10 SASI_Mm02_00327473 predicted 312
11 SASI_Mm01_00062358 predicted 260
12 SASI_Mm01_00062361 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024169
VALIDATED
FKBP11 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 11, 19 kDa
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-149s21c1
Sequence:CCGGGTTACTGCTGCTACTGTTCAGCTCGAGCTGAACAGTAGCAGCAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-628s21c1
Sequence:CCGGTCGGGTATCACCTGTACAGAACTCGAGTTCTGTACAGGTGATACCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-450s21c1
Sequence:CCGGATTCCTTCTCACCTGGCTTATCTCGAGATAAGCCAGGTGAGAAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-562s21c1
Sequence:CCGGAGAAGCTGCTAAAGAGCATTTCTCGAGAAATGCTCTTTAGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-253s21c1
Sequence:CCGGCTGAATCGTGCACGGAATCTGCTCGAGCAGATTCCGTGCACGATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-315s21c1
Sequence:CCGGTTGGTAGATGGACGCATTATTCTCGAGAATAATGCGTCCATCTACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-536s21c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-361s21c1
Sequence:CCGGTGGTCATAGAACTCGGCCAAACTCGAGTTTGGCCGAGTTCTATGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-449s1c1
Sequence:CCGGTCATTCCTTCTCACCTGGCTTCTCGAGAAGCCAGGTGAGAAGGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-337s1c1
Sequence:CCGGGACACTTCTCTGACCAGAGATCTCGAGATCTCTGGTCAGAGAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-537s1c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-314s1c1
Sequence:CCGGGTTTGGTAGATGGACGCATTACTCGAGTAATGCGTCCATCTACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-297s1c1
Sequence:CCGGCATACACTACACGGGCAGTTTCTCGAGAAACTGCCCGTGTAGTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024169
VALIDATED
FKBP11 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 11, 19 kDa
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-149s21c1
Sequence:CCGGGTTACTGCTGCTACTGTTCAGCTCGAGCTGAACAGTAGCAGCAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-628s21c1
Sequence:CCGGTCGGGTATCACCTGTACAGAACTCGAGTTCTGTACAGGTGATACCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-450s21c1
Sequence:CCGGATTCCTTCTCACCTGGCTTATCTCGAGATAAGCCAGGTGAGAAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-562s21c1
Sequence:CCGGAGAAGCTGCTAAAGAGCATTTCTCGAGAAATGCTCTTTAGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-253s21c1
Sequence:CCGGCTGAATCGTGCACGGAATCTGCTCGAGCAGATTCCGTGCACGATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-315s21c1
Sequence:CCGGTTGGTAGATGGACGCATTATTCTCGAGAATAATGCGTCCATCTACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-536s21c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-361s21c1
Sequence:CCGGTGGTCATAGAACTCGGCCAAACTCGAGTTTGGCCGAGTTCTATGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-449s1c1
Sequence:CCGGTCATTCCTTCTCACCTGGCTTCTCGAGAAGCCAGGTGAGAAGGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-337s1c1
Sequence:CCGGGACACTTCTCTGACCAGAGATCTCGAGATCTCTGGTCAGAGAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-537s1c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-314s1c1
Sequence:CCGGGTTTGGTAGATGGACGCATTACTCGAGTAATGCGTCCATCTACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-297s1c1
Sequence:CCGGCATACACTACACGGGCAGTTTCTCGAGAAACTGCCCGTGTAGTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024169
VALIDATED
FKBP11 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 11, 19 kDa
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-149s21c1
Sequence:CCGGGTTACTGCTGCTACTGTTCAGCTCGAGCTGAACAGTAGCAGCAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-628s21c1
Sequence:CCGGTCGGGTATCACCTGTACAGAACTCGAGTTCTGTACAGGTGATACCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-450s21c1
Sequence:CCGGATTCCTTCTCACCTGGCTTATCTCGAGATAAGCCAGGTGAGAAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-562s21c1
Sequence:CCGGAGAAGCTGCTAAAGAGCATTTCTCGAGAAATGCTCTTTAGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-253s21c1
Sequence:CCGGCTGAATCGTGCACGGAATCTGCTCGAGCAGATTCCGTGCACGATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-315s21c1
Sequence:CCGGTTGGTAGATGGACGCATTATTCTCGAGAATAATGCGTCCATCTACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-536s21c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024169.3-361s21c1
Sequence:CCGGTGGTCATAGAACTCGGCCAAACTCGAGTTTGGCCGAGTTCTATGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-449s1c1
Sequence:CCGGTCATTCCTTCTCACCTGGCTTCTCGAGAAGCCAGGTGAGAAGGAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-337s1c1
Sequence:CCGGGACACTTCTCTGACCAGAGATCTCGAGATCTCTGGTCAGAGAAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-537s1c1
Sequence:CCGGCGCTTTGATTCGAGCCAACTACTCGAGTAGTTGGCTCGAATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-314s1c1
Sequence:CCGGGTTTGGTAGATGGACGCATTACTCGAGTAATGCGTCCATCTACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024169.2-297s1c1
Sequence:CCGGCATACACTACACGGGCAGTTTCTCGAGAAACTGCCCGTGTAGTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016594
VALIDATED
FKBP11 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 11, 19 kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-551s21c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-319s21c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-530s21c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-439s21c1
Sequence:CCGGAGAAGCGAAGGGCAATCATTCCTCGAGGAATGATTGCCCTTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-286s21c1
Sequence:CCGGTTGGAGACACGCTTCACATACCTCGAGGTATGTGAAGCGTGTCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-272s1c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016594.1-504s1c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-483s1c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-273s1c1
Sequence:CCGGCTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-495s1c1
Sequence:CCGGTGCACTAATCCGAGCCAACTACTCGAGTAGTTGGCTCGGATTAGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016594
VALIDATED
FKBP11 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 11, 19 kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-551s21c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-319s21c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-530s21c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-439s21c1
Sequence:CCGGAGAAGCGAAGGGCAATCATTCCTCGAGGAATGATTGCCCTTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-286s21c1
Sequence:CCGGTTGGAGACACGCTTCACATACCTCGAGGTATGTGAAGCGTGTCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-272s1c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016594.1-504s1c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-483s1c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-273s1c1
Sequence:CCGGCTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-495s1c1
Sequence:CCGGTGCACTAATCCGAGCCAACTACTCGAGTAGTTGGCTCGGATTAGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016594
VALIDATED
FKBP11 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 11, 19 kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-551s21c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-319s21c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016594.2-530s21c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-439s21c1
Sequence:CCGGAGAAGCGAAGGGCAATCATTCCTCGAGGAATGATTGCCCTTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016594.2-286s21c1
Sequence:CCGGTTGGAGACACGCTTCACATACCTCGAGGTATGTGAAGCGTGTCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-272s1c1
Sequence:CCGGGCTTGGTAGATGGACGTATTACTCGAGTAATACGTCCATCTACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016594.1-504s1c1
Sequence:CCGGCCGAGCCAACTACTGGCTAAACTCGAGTTTAGCCAGTAGTTGGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-483s1c1
Sequence:CCGGCGTGGAGCTGATTGCACTAATCTCGAGATTAGTGCAATCAGCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-273s1c1
Sequence:CCGGCTTGGTAGATGGACGTATTATCTCGAGATAATACGTCCATCTACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016594.1-495s1c1
Sequence:CCGGTGCACTAATCCGAGCCAACTACTCGAGTAGTTGGCTCGGATTAGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)