EMAIL THIS PAGE TO A FRIEND

FKBP14

FK506 binding protein 14, 22 kDa

87 Gene Product Result for
Synonyms: EDSKMH FKBP22 IPBP12
UniProtKB ID: Q9NWM8
Gene ID:
Human(55033) Summary: The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Mouse(231997) FK506 binding protein 14
Rat(362366) FK506 binding protein 14
Zebrafish(445077) FK506 binding protein 14
chicken(420636) FK506 binding protein 14, 22 kDa
domestic cat(101086467) FK506 binding protein 14, 22 kDa
cow(615718) FK506 binding protein 14, 22 kDa
dog(611546) FK506 binding protein 14, 22 kDa
sheep(101103228) FK506 binding protein 14, 22 kDa
domestic guinea pig(100712818) FK506 binding protein 14, 22 kDa
naked mole-rat(101699277) FK506 binding protein 14, 22 kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018631 MISSION® esiRNA esiRNA targeting human FKBP14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017946 Rosetta Predictions human pricing
NM_001013210 Rosetta Predictions rat pricing
NM_153573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168800 predicted 288
2 SASI_Hs01_00168801 predicted 294
3 SASI_Hs01_00168802 predicted 1099
4 SASI_Hs01_00168803 predicted 316
5 SASI_Hs02_00350963 predicted 1107
6 SASI_Hs01_00168805 predicted 274
7 SASI_Hs01_00168806 predicted 574
8 SASI_Hs01_00168808 predicted 599
9 SASI_Hs01_00168809 predicted 238
10 SASI_Hs02_00350964 predicted 1105
11 SASI_Hs01_00168804 predicted 599
12 SASI_Hs01_00168807 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105514 predicted 261
2 SASI_Rn01_00105515 predicted 523
3 SASI_Rn01_00105516 predicted 475
4 SASI_Rn02_00201001 predicted 289
5 SASI_Rn01_00105517 predicted 373
6 SASI_Rn01_00105518 predicted 1090
7 SASI_Rn01_00105519 predicted 479
8 SASI_Rn01_00105520 predicted 488
9 SASI_Rn01_00105521 predicted 1103
10 SASI_Rn01_00105522 predicted 573
11 SASI_Rn01_00105513 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025143 predicted 547
2 SASI_Mm01_00025144 predicted 440
3 SASI_Mm01_00025145 predicted 553
4 SASI_Mm02_00343379 predicted 548
5 SASI_Mm01_00025147 predicted 454
6 SASI_Mm01_00025148 predicted 1222
7 SASI_Mm01_00025149 predicted 462
8 SASI_Mm01_00025150 predicted 313
9 SASI_Mm02_00343380 predicted 1181
10 SASI_Mm01_00025151 predicted 306
11 SASI_Mm01_00025142 predicted 1079
12 SASI_Mm01_00025146 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017946
VALIDATED
FKBP14 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 14, 22 kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-246s21c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-607s21c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-504s21c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-661s21c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-505s1c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-608s1c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-247s1c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017946.1-662s1c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-587s1c1
Sequence:CCGGGATCTTAATGATGACTGGAAACTCGAGTTTCCAGTCATCATTAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017946
VALIDATED
FKBP14 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 14, 22 kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-246s21c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-607s21c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-504s21c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-661s21c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-505s1c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-608s1c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-247s1c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017946.1-662s1c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-587s1c1
Sequence:CCGGGATCTTAATGATGACTGGAAACTCGAGTTTCCAGTCATCATTAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017946
VALIDATED
FKBP14 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 14, 22 kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-246s21c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-607s21c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-504s21c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017946.2-661s21c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-505s1c1
Sequence:CCGGCCCAGAAAGTACACTGATATTCTCGAGAATATCAGTGTACTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-608s1c1
Sequence:CCGGCTCTCTAAAGATGAGGTTAAACTCGAGTTTAACCTCATCTTTAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-247s1c1
Sequence:CCGGGCCATTCATCTGCCATCGCAACTCGAGTTGCGATGGCAGATGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017946.1-662s1c1
Sequence:CCGGGCGGTGGTGAATGAAAGTCATCTCGAGATGACTTTCATTCACCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017946.1-587s1c1
Sequence:CCGGGATCTTAATGATGACTGGAAACTCGAGTTTCCAGTCATCATTAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153573
VALIDATED
FKBP14 MISSION shRNA Bacterial Glycerol Stock
FK506 binding protein 14, 22 kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-1345s1c1
Sequence:CCGGCCTTGTAATCAACACACCAAACTCGAGTTTGGTGTGTTGATTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-268s1c1
Sequence:CCGGCCTGTTTCATTCCACTCACAACTCGAGTTGTGAGTGGAATGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-505s1c1
Sequence:CCGGCCACGAGTCGTTTCAAGAAATCTCGAGATTTCTTGAAACGACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153573.1-675s1c1
Sequence:CCGGGATTTATATCTGCCAGAGAATCTCGAGATTCTCTGGCAGATATAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-556s1c1
Sequence:CCGGGCATGAGGTTAAAGTGTATTTCTCGAGAAATACACTTTAACCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153573
VALIDATED
FKBP14 MISSION shRNA shRNA Plasmid DNA
FK506 binding protein 14, 22 kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-1345s1c1
Sequence:CCGGCCTTGTAATCAACACACCAAACTCGAGTTTGGTGTGTTGATTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-268s1c1
Sequence:CCGGCCTGTTTCATTCCACTCACAACTCGAGTTGTGAGTGGAATGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-505s1c1
Sequence:CCGGCCACGAGTCGTTTCAAGAAATCTCGAGATTTCTTGAAACGACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153573.1-675s1c1
Sequence:CCGGGATTTATATCTGCCAGAGAATCTCGAGATTCTCTGGCAGATATAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-556s1c1
Sequence:CCGGGCATGAGGTTAAAGTGTATTTCTCGAGAAATACACTTTAACCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153573
VALIDATED
FKBP14 MISSION shRNA Lentiviral Transduction Particles
FK506 binding protein 14, 22 kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-1345s1c1
Sequence:CCGGCCTTGTAATCAACACACCAAACTCGAGTTTGGTGTGTTGATTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-268s1c1
Sequence:CCGGCCTGTTTCATTCCACTCACAACTCGAGTTGTGAGTGGAATGAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-505s1c1
Sequence:CCGGCCACGAGTCGTTTCAAGAAATCTCGAGATTTCTTGAAACGACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153573.1-675s1c1
Sequence:CCGGGATTTATATCTGCCAGAGAATCTCGAGATTCTCTGGCAGATATAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153573.1-556s1c1
Sequence:CCGGGCATGAGGTTAAAGTGTATTTCTCGAGAAATACACTTTAACCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)