EMAIL THIS PAGE TO A FRIEND

FLJ34503

42 Gene Product Result for
Species: Human FLJ34503(285759)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039528 Rosetta Predictions human pricing
XR_040042 Rosetta Predictions human pricing
XR_040043 Rosetta Predictions human pricing
XR_040044 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052948 predicted 1273
2 SASI_Hs01_00052949 predicted 1052
3 SASI_Hs01_00052950 predicted 952
4 SASI_Hs01_00052951 predicted 1216
5 SASI_Hs01_00052952 predicted 1174
6 SASI_Hs01_00052953 predicted 1001
7 SASI_Hs01_00052954 predicted 1202
8 SASI_Hs01_00052955 predicted 367
9 SASI_Hs01_00052956 predicted 1208
10 SASI_Hs01_00052957 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515424 predicted 330
2 SASI_Hs02_00515425 predicted 357
3 SASI_Hs02_00515426 predicted 360
4 SASI_Hs02_00515427 predicted 339
5 SASI_Hs02_00515428 predicted 335
6 SASI_Hs02_00515429 predicted 329
7 SASI_Hs02_00515430 predicted 344
8 SASI_Hs02_00515431 predicted 340
9 SASI_Hs02_00515432 predicted 942
10 SASI_Hs02_00515433 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515434 predicted 328
2 SASI_Hs02_00515435 predicted 354
3 SASI_Hs02_00515436 predicted 362
4 SASI_Hs02_00515437 predicted 332
5 SASI_Hs02_00515438 predicted 339
6 SASI_Hs02_00515439 predicted 329
7 SASI_Hs02_00515440 predicted 349
8 SASI_Hs02_00515441 predicted 349
9 SASI_Hs02_00515442 predicted 944
10 SASI_Hs02_00515443 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515444 predicted 329
2 SASI_Hs02_00515445 predicted 361
3 SASI_Hs02_00515446 predicted 355
4 SASI_Hs02_00515447 predicted 336
5 SASI_Hs02_00515448 predicted 339
6 SASI_Hs02_00515449 predicted 331
7 SASI_Hs02_00515450 predicted 349
8 SASI_Hs02_00515451 predicted 346
9 SASI_Hs02_00515452 predicted 942
10 SASI_Hs02_00515453 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173673
FLJ34503 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-573s1c1
Sequence:CCGGCAATTGGACGTTGTTACAGATCTCGAGATCTGTAACAACGTCCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-550s1c1
Sequence:CCGGGTCATCTTCTTTCCTCTCAAACTCGAGTTTGAGAGGAAAGAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1495s1c1
Sequence:CCGGCCTTGCATTCTGGAAGTGAAACTCGAGTTTCACTTCCAGAATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-451s1c1
Sequence:CCGGCCAGTGCCTTTGTTTATCCGACTCGAGTCGGATAAACAAAGGCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-480s1c1
Sequence:CCGGGATCCCACTGTGAAGTCTGAACTCGAGTTCAGACTTCACAGTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-447s1c1
Sequence:CCGGCCTGCCAGTGCCTTTGTTTATCTCGAGATAAACAAAGGCACTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-691s1c1
Sequence:CCGGCTACACCCTCACTAGCACTTACTCGAGTAAGTGCTAGTGAGGGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-529s1c1
Sequence:CCGGCTAGATGCTGTGTCTCCCAATCTCGAGATTGGGAGACACAGCATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1452s1c1
Sequence:CCGGCCTCTGTTTAGCTCATTACTTCTCGAGAAGTAATGAGCTAAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-729s1c1
Sequence:CCGGCTGGATTCACAGAAGGACAAACTCGAGTTTGTCCTTCTGTGAATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173673
FLJ34503 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-573s1c1
Sequence:CCGGCAATTGGACGTTGTTACAGATCTCGAGATCTGTAACAACGTCCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-550s1c1
Sequence:CCGGGTCATCTTCTTTCCTCTCAAACTCGAGTTTGAGAGGAAAGAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1495s1c1
Sequence:CCGGCCTTGCATTCTGGAAGTGAAACTCGAGTTTCACTTCCAGAATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-451s1c1
Sequence:CCGGCCAGTGCCTTTGTTTATCCGACTCGAGTCGGATAAACAAAGGCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-480s1c1
Sequence:CCGGGATCCCACTGTGAAGTCTGAACTCGAGTTCAGACTTCACAGTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-447s1c1
Sequence:CCGGCCTGCCAGTGCCTTTGTTTATCTCGAGATAAACAAAGGCACTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-691s1c1
Sequence:CCGGCTACACCCTCACTAGCACTTACTCGAGTAAGTGCTAGTGAGGGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-529s1c1
Sequence:CCGGCTAGATGCTGTGTCTCCCAATCTCGAGATTGGGAGACACAGCATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1452s1c1
Sequence:CCGGCCTCTGTTTAGCTCATTACTTCTCGAGAAGTAATGAGCTAAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-729s1c1
Sequence:CCGGCTGGATTCACAGAAGGACAAACTCGAGTTTGTCCTTCTGTGAATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173673
FLJ34503 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-573s1c1
Sequence:CCGGCAATTGGACGTTGTTACAGATCTCGAGATCTGTAACAACGTCCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-550s1c1
Sequence:CCGGGTCATCTTCTTTCCTCTCAAACTCGAGTTTGAGAGGAAAGAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1495s1c1
Sequence:CCGGCCTTGCATTCTGGAAGTGAAACTCGAGTTTCACTTCCAGAATGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-451s1c1
Sequence:CCGGCCAGTGCCTTTGTTTATCCGACTCGAGTCGGATAAACAAAGGCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-480s1c1
Sequence:CCGGGATCCCACTGTGAAGTCTGAACTCGAGTTCAGACTTCACAGTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-447s1c1
Sequence:CCGGCCTGCCAGTGCCTTTGTTTATCTCGAGATAAACAAAGGCACTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-691s1c1
Sequence:CCGGCTACACCCTCACTAGCACTTACTCGAGTAAGTGCTAGTGAGGGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-529s1c1
Sequence:CCGGCTAGATGCTGTGTCTCCCAATCTCGAGATTGGGAGACACAGCATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173673.1-1452s1c1
Sequence:CCGGCCTCTGTTTAGCTCATTACTTCTCGAGAAGTAATGAGCTAAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173673.1-729s1c1
Sequence:CCGGCTGGATTCACAGAAGGACAAACTCGAGTTTGTCCTTCTGTGAATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)