EMAIL THIS PAGE TO A FRIEND

FLJ44796

Gene Product Result for
Species: Human FLJ44796(401209)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001704
FLJ44796 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-516s1c1
Sequence:CCGGCAGATTCACCAAGGTTGAAATCTCGAGATTTCAACCTTGGTGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-334s1c1
Sequence:CCGGCGTTTGATTGGTGTACCTGAACTCGAGTTCAGGTACACCAATCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-2349s1c1
Sequence:CCGGCCAGACAGATTCACAGCCAAACTCGAGTTTGGCTGTGAATCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-1846s1c1
Sequence:CCGGCCCACAAGAGAAAGCAGGAAACTCGAGTTTCCTGCTTTCTCTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001704.1-420s1c1
Sequence:CCGGCAACTTAGCAAAGCAGGCCAACTCGAGTTGGCCTGCTTTGCTAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-360s1c1
Sequence:CCGGCAGGGAGAATGGAACCAAGTTCTCGAGAACTTGGTTCCATTCTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-813s1c1
Sequence:CCGGGCACTAAACATGGAAAGGAAACTCGAGTTTCCTTTCCATGTTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-884s1c1
Sequence:CCGGGCTATGAAGAAACTGCATGAACTCGAGTTCATGCAGTTTCTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-500s1c1
Sequence:CCGGCAAGACACATAATTGGCAGATCTCGAGATCTGCCAATTATGTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-524s1c1
Sequence:CCGGCCAAGGTTGAAATGAAGGAAACTCGAGTTTCCTTCATTTCAACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001704
FLJ44796 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-516s1c1
Sequence:CCGGCAGATTCACCAAGGTTGAAATCTCGAGATTTCAACCTTGGTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-334s1c1
Sequence:CCGGCGTTTGATTGGTGTACCTGAACTCGAGTTCAGGTACACCAATCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-2349s1c1
Sequence:CCGGCCAGACAGATTCACAGCCAAACTCGAGTTTGGCTGTGAATCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-1846s1c1
Sequence:CCGGCCCACAAGAGAAAGCAGGAAACTCGAGTTTCCTGCTTTCTCTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001704.1-420s1c1
Sequence:CCGGCAACTTAGCAAAGCAGGCCAACTCGAGTTGGCCTGCTTTGCTAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-360s1c1
Sequence:CCGGCAGGGAGAATGGAACCAAGTTCTCGAGAACTTGGTTCCATTCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-813s1c1
Sequence:CCGGGCACTAAACATGGAAAGGAAACTCGAGTTTCCTTTCCATGTTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-884s1c1
Sequence:CCGGGCTATGAAGAAACTGCATGAACTCGAGTTCATGCAGTTTCTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-500s1c1
Sequence:CCGGCAAGACACATAATTGGCAGATCTCGAGATCTGCCAATTATGTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-524s1c1
Sequence:CCGGCCAAGGTTGAAATGAAGGAAACTCGAGTTTCCTTCATTTCAACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001704
FLJ44796 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-516s1c1
Sequence:CCGGCAGATTCACCAAGGTTGAAATCTCGAGATTTCAACCTTGGTGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-334s1c1
Sequence:CCGGCGTTTGATTGGTGTACCTGAACTCGAGTTCAGGTACACCAATCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-2349s1c1
Sequence:CCGGCCAGACAGATTCACAGCCAAACTCGAGTTTGGCTGTGAATCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-1846s1c1
Sequence:CCGGCCCACAAGAGAAAGCAGGAAACTCGAGTTTCCTGCTTTCTCTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001704.1-420s1c1
Sequence:CCGGCAACTTAGCAAAGCAGGCCAACTCGAGTTGGCCTGCTTTGCTAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-360s1c1
Sequence:CCGGCAGGGAGAATGGAACCAAGTTCTCGAGAACTTGGTTCCATTCTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001704.1-813s1c1
Sequence:CCGGGCACTAAACATGGAAAGGAAACTCGAGTTTCCTTTCCATGTTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001704.1-884s1c1
Sequence:CCGGGCTATGAAGAAACTGCATGAACTCGAGTTCATGCAGTTTCTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-500s1c1
Sequence:CCGGCAAGACACATAATTGGCAGATCTCGAGATCTGCCAATTATGTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001704.1-524s1c1
Sequence:CCGGCCAAGGTTGAAATGAAGGAAACTCGAGTTTCCTTCATTTCAACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376428
FLJ44796 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-437s1c1
Sequence:CCGGCCAACATTCAAATTCAGGATACTCGAGTATCCTGAATTTGAATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-1737s1c1
Sequence:CCGGGCAGAAATAAAGACGTTCTTTCTCGAGAAAGAACGTCTTTATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-706s1c1
Sequence:CCGGCCAGCCAAACTAAGCTTCATACTCGAGTATGAAGCTTAGTTTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-2716s1c1
Sequence:CCGGCGCTTGATTATCTCAATAGATCTCGAGATCTATTGAGATAATCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376428
FLJ44796 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-437s1c1
Sequence:CCGGCCAACATTCAAATTCAGGATACTCGAGTATCCTGAATTTGAATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-1737s1c1
Sequence:CCGGGCAGAAATAAAGACGTTCTTTCTCGAGAAAGAACGTCTTTATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-706s1c1
Sequence:CCGGCCAGCCAAACTAAGCTTCATACTCGAGTATGAAGCTTAGTTTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-2716s1c1
Sequence:CCGGCGCTTGATTATCTCAATAGATCTCGAGATCTATTGAGATAATCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376428
FLJ44796 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-437s1c1
Sequence:CCGGCCAACATTCAAATTCAGGATACTCGAGTATCCTGAATTTGAATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-1737s1c1
Sequence:CCGGGCAGAAATAAAGACGTTCTTTCTCGAGAAAGAACGTCTTTATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376428.1-706s1c1
Sequence:CCGGCCAGCCAAACTAAGCTTCATACTCGAGTATGAAGCTTAGTTTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376428.1-2716s1c1
Sequence:CCGGCGCTTGATTATCTCAATAGATCTCGAGATCTATTGAGATAATCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)