EMAIL THIS PAGE TO A FRIEND

FLRT1

fibronectin leucine rich transmembrane protein 1

66 Gene Product Result for
UniProtKB ID: Q9NZU1, Q8WVA2
Gene ID:
Human(23769) Summary: This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
Mouse(396184) fibronectin leucine rich transmembrane protein 1
Rat(499308) fibronectin leucine rich transmembrane protein 1
dog(483767) fibronectin leucine rich transmembrane protein 1
domestic cat(101097095) fibronectin leucine rich transmembrane protein 1
Horse(100147627) fibronectin leucine rich transmembrane protein 1
cow(788007) fibronectin leucine rich transmembrane protein 1
domestic guinea pig(100715878) fibronectin leucine rich transmembrane protein 1
naked mole-rat(101704927) fibronectin leucine rich transmembrane protein 1
sheep(101122315) fibronectin leucine rich transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1461 Human FLRT1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013280 Rosetta Predictions human pricing
NM_001109160 Rosetta Predictions rat pricing
NM_201411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170779 predicted 1880
2 SASI_Hs01_00170780 predicted 1690
3 SASI_Hs01_00170781 predicted 1088
4 SASI_Hs01_00170782 predicted 2225
5 SASI_Hs01_00170784 predicted 662
6 SASI_Hs02_00344535 predicted 862
7 SASI_Hs01_00170785 predicted 1450
8 SASI_Hs01_00170786 predicted 1875
9 SASI_Hs01_00170787 predicted 1842
10 SASI_Hs02_00344536 predicted 1641
11 SASI_Hs01_00170783 predicted 2163
12 SASI_Hs01_00170788 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245720 predicted 1604
2 SASI_Rn02_00245721 predicted 1540
3 SASI_Rn02_00245722 predicted 1945
4 SASI_Rn02_00245723 predicted 1813
5 SASI_Rn02_00245724 predicted 1346
6 SASI_Rn02_00245725 predicted 319
7 SASI_Rn02_00245726 predicted 1906
8 SASI_Rn02_00245727 predicted 1495
9 SASI_Rn02_00245728 predicted 828
10 SASI_Rn02_00245729 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034170 predicted 2512
2 SASI_Mm01_00034171 predicted 2032
3 SASI_Mm01_00034172 predicted 2044
4 SASI_Mm01_00034173 predicted 2642
5 SASI_Mm01_00034174 predicted 2595
6 SASI_Mm01_00034176 predicted 2195
7 SASI_Mm01_00034177 predicted 1013
8 SASI_Mm01_00034178 predicted 802
9 SASI_Mm02_00351593 predicted 1334
10 SASI_Mm01_00034175 predicted 1851
11 SASI_Mm01_00034169 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013280
FLRT1 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-519s21c1
Sequence:CCGGTGCGACAACGGCTTCATCTACCTCGAGGTAGATGAAGCCGTTGTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-656s21c1
Sequence:CCGGGGTCAACGTGCAGGTCATCTACTCGAGTAGATGACCTGCACGTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-678s1c1
Sequence:CCGGCTATACGAGAATGACCTGGATCTCGAGATCCAGGTCATTCTCGTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-605s1c1
Sequence:CCGGGCAGAACAACCAGATCAACAACTCGAGTTGTTGATCTGGTTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-524s1c1
Sequence:CCGGCAACGGCTTCATCTACTGCAACTCGAGTTGCAGTAGATGAAGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-747s1c1
Sequence:CCGGGACAACAATGTGCGCACCATTCTCGAGAATGGTGCGCACATTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-2237s1c1
Sequence:CCGGGTACGTGGTCCACACTATCTTCTCGAGAAGATAGTGTGGACCACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-1566s1c1
Sequence:CCGGCTGTTTACCCTCAAGGCCAAACTCGAGTTTGGCCTTGAGGGTAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-1850s1c1
Sequence:CCGGCATCATCTGCATGGTCACCATCTCGAGATGGTGACCATGCAGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013280
FLRT1 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-519s21c1
Sequence:CCGGTGCGACAACGGCTTCATCTACCTCGAGGTAGATGAAGCCGTTGTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-656s21c1
Sequence:CCGGGGTCAACGTGCAGGTCATCTACTCGAGTAGATGACCTGCACGTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-678s1c1
Sequence:CCGGCTATACGAGAATGACCTGGATCTCGAGATCCAGGTCATTCTCGTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-605s1c1
Sequence:CCGGGCAGAACAACCAGATCAACAACTCGAGTTGTTGATCTGGTTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-524s1c1
Sequence:CCGGCAACGGCTTCATCTACTGCAACTCGAGTTGCAGTAGATGAAGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-747s1c1
Sequence:CCGGGACAACAATGTGCGCACCATTCTCGAGAATGGTGCGCACATTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-2237s1c1
Sequence:CCGGGTACGTGGTCCACACTATCTTCTCGAGAAGATAGTGTGGACCACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-1566s1c1
Sequence:CCGGCTGTTTACCCTCAAGGCCAAACTCGAGTTTGGCCTTGAGGGTAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-1850s1c1
Sequence:CCGGCATCATCTGCATGGTCACCATCTCGAGATGGTGACCATGCAGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013280
FLRT1 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-519s21c1
Sequence:CCGGTGCGACAACGGCTTCATCTACCTCGAGGTAGATGAAGCCGTTGTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013280.4-656s21c1
Sequence:CCGGGGTCAACGTGCAGGTCATCTACTCGAGTAGATGACCTGCACGTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-678s1c1
Sequence:CCGGCTATACGAGAATGACCTGGATCTCGAGATCCAGGTCATTCTCGTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-605s1c1
Sequence:CCGGGCAGAACAACCAGATCAACAACTCGAGTTGTTGATCTGGTTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-524s1c1
Sequence:CCGGCAACGGCTTCATCTACTGCAACTCGAGTTGCAGTAGATGAAGCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-747s1c1
Sequence:CCGGGACAACAATGTGCGCACCATTCTCGAGAATGGTGCGCACATTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-2237s1c1
Sequence:CCGGGTACGTGGTCCACACTATCTTCTCGAGAAGATAGTGTGGACCACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013280.3-1566s1c1
Sequence:CCGGCTGTTTACCCTCAAGGCCAAACTCGAGTTTGGCCTTGAGGGTAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013280.3-1850s1c1
Sequence:CCGGCATCATCTGCATGGTCACCATCTCGAGATGGTGACCATGCAGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201411
FLRT1 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-1910s1c1
Sequence:CCGGCCCAGACTCCAACATTGACTACTCGAGTAGTCAATGTTGGAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201411.1-2695s1c1
Sequence:CCGGGCACCGGTGTGTCACGTGGCTCTCGAGAGCCACGTGACACACCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-2552s1c1
Sequence:CCGGGCACACCATATTTCCCTCCAACTCGAGTTGGAGGGAAATATGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-908s1c1
Sequence:CCGGCCTACAGAACAACCAGATCAACTCGAGTTGATCTGGTTGTTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-752s1c1
Sequence:CCGGGTTTCTCTGTTATGGGCTCATCTCGAGATGAGCCCATAACAGAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201411
FLRT1 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-1910s1c1
Sequence:CCGGCCCAGACTCCAACATTGACTACTCGAGTAGTCAATGTTGGAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201411.1-2695s1c1
Sequence:CCGGGCACCGGTGTGTCACGTGGCTCTCGAGAGCCACGTGACACACCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-2552s1c1
Sequence:CCGGGCACACCATATTTCCCTCCAACTCGAGTTGGAGGGAAATATGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-908s1c1
Sequence:CCGGCCTACAGAACAACCAGATCAACTCGAGTTGATCTGGTTGTTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-752s1c1
Sequence:CCGGGTTTCTCTGTTATGGGCTCATCTCGAGATGAGCCCATAACAGAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201411
FLRT1 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-1910s1c1
Sequence:CCGGCCCAGACTCCAACATTGACTACTCGAGTAGTCAATGTTGGAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201411.1-2695s1c1
Sequence:CCGGGCACCGGTGTGTCACGTGGCTCTCGAGAGCCACGTGACACACCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-2552s1c1
Sequence:CCGGGCACACCATATTTCCCTCCAACTCGAGTTGGAGGGAAATATGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-908s1c1
Sequence:CCGGCCTACAGAACAACCAGATCAACTCGAGTTGATCTGGTTGTTCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201411.1-752s1c1
Sequence:CCGGGTTTCTCTGTTATGGGCTCATCTCGAGATGAGCCCATAACAGAGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)