EMAIL THIS PAGE TO A FRIEND

FLT1P1

fms-related tyrosine kinase 1 pseudogene 1

Gene Product Result for
Species: Human FLT1P1(391533)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497921
FLT1P1 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-1108s1c1
Sequence:CCGGGACTTGAGACTAACTAGCAAACTCGAGTTTGCTAGTTAGTCTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-105s1c1
Sequence:CCGGAGCAAACAAAGGGCCTCTGATCTCGAGATCAGAGGCCCTTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-933s1c1
Sequence:CCGGCGTAAATGCTTTCAAGTTCATCTCGAGATGAACTTGAAAGCATTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-118s1c1
Sequence:CCGGCCTCTGATGGTGATTGTTGAACTCGAGTTCAACAATCACCATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-311s1c1
Sequence:CCGGGCTCCAAGTTTCAGGAAGATACTCGAGTATCTTCCTGAAACTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497921
FLT1P1 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-1108s1c1
Sequence:CCGGGACTTGAGACTAACTAGCAAACTCGAGTTTGCTAGTTAGTCTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-105s1c1
Sequence:CCGGAGCAAACAAAGGGCCTCTGATCTCGAGATCAGAGGCCCTTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-933s1c1
Sequence:CCGGCGTAAATGCTTTCAAGTTCATCTCGAGATGAACTTGAAAGCATTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-118s1c1
Sequence:CCGGCCTCTGATGGTGATTGTTGAACTCGAGTTCAACAATCACCATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-311s1c1
Sequence:CCGGGCTCCAAGTTTCAGGAAGATACTCGAGTATCTTCCTGAAACTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497921
FLT1P1 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-1108s1c1
Sequence:CCGGGACTTGAGACTAACTAGCAAACTCGAGTTTGCTAGTTAGTCTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-105s1c1
Sequence:CCGGAGCAAACAAAGGGCCTCTGATCTCGAGATCAGAGGCCCTTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-933s1c1
Sequence:CCGGCGTAAATGCTTTCAAGTTCATCTCGAGATGAACTTGAAAGCATTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-118s1c1
Sequence:CCGGCCTCTGATGGTGATTGTTGAACTCGAGTTCAACAATCACCATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497921.1-311s1c1
Sequence:CCGGGCTCCAAGTTTCAGGAAGATACTCGAGTATCTTCCTGAAACTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)