EMAIL THIS PAGE TO A FRIEND

FN3KRP

fructosamine 3 kinase related protein

64 Gene Product Result for
Synonyms: FN3KL
UniProtKB ID: Q9HA64, Q969F4, Q9H0U7
Gene ID:
Human(79672) Summary: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(238024) fructosamine 3 kinase related protein
Rat(303755) fructosamine-3-kinase-related protein
sheep(101108669) fructosamine 3 kinase related protein
domestic guinea pig(100718087) fructosamine 3 kinase related protein
naked mole-rat(101709333) fructosamine 3 kinase related protein
Zebrafish(559954) fructosamine-3-kinase-related protein
cow(615868) fructosamine 3 kinase related protein
domestic cat(101092971) fructosamine 3 kinase related protein
dog(480821) fructosamine 3 kinase related protein
chicken(417336) fructosamine 3 kinase related protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024619 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024619 Rosetta Predictions human pricing
NM_001107077 Rosetta Predictions rat pricing
NM_181420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139779 predicted 1156
2 SASI_Hs01_00139780 predicted 1170
3 SASI_Hs01_00139783 predicted 746
4 SASI_Hs01_00139784 predicted 944
5 SASI_Hs01_00139785 predicted 435
6 SASI_Hs01_00139786 predicted 1041
7 SASI_Hs01_00139787 predicted 730
8 SASI_Hs01_00139788 predicted 1179
9 SASI_Hs02_00356995 predicted 1385
10 SASI_Hs02_00356996 predicted 1450
11 SASI_Hs01_00139781 predicted 353
12 SASI_Hs01_00139782 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225266 predicted 470
2 SASI_Rn02_00225267 predicted 776
3 SASI_Rn02_00225268 predicted 211
4 SASI_Rn02_00225269 predicted 508
5 SASI_Rn02_00225270 predicted 227
6 SASI_Rn02_00225271 predicted 349
7 SASI_Rn02_00225272 predicted 899
8 SASI_Rn02_00225273 predicted 871
9 SASI_Rn02_00225274 predicted 757
10 SASI_Rn02_00225275 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135791 predicted 507
2 SASI_Mm01_00135792 predicted 345
3 SASI_Mm01_00135793 predicted 207
4 SASI_Mm01_00135794 predicted 774
5 SASI_Mm01_00135795 predicted 277
6 SASI_Mm01_00135796 predicted 882
7 SASI_Mm02_00349779 predicted 694
8 SASI_Mm01_00135797 predicted 504
9 SASI_Mm01_00135798 predicted 513
10 SASI_Mm01_00135799 predicted 849
11 SASI_Mm01_00135800 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181420
FN3KRP MISSION shRNA Bacterial Glycerol Stock
fructosamine 3 kinase related protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1150s21c1
Sequence:CCGGGTGACCTGACTCCAACGATTTCTCGAGAAATCGTTGGAGTCAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1093s21c1
Sequence:CCGGGATCAAGTCTTAGCATCATACCTCGAGGTATGATGCTAAGACTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-827s21c1
Sequence:CCGGTGGCAATAGCGGGCATGTTTGCTCGAGCAAACATGCCCGCTATTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-176s21c1
Sequence:CCGGAGAGTTATGACACGGACAAAGCTCGAGCTTTGTCCGTGTCATAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-120s1c1
Sequence:CCGGCCAGAGTTATGACACGGACAACTCGAGTTGTCCGTGTCATAACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-301s1c1
Sequence:CCGGGAGCATTTGGACATGCGGTATCTCGAGATACCGCATGTCCAAATGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-933s1c1
Sequence:CCGGCTCTCTAAACATAATGAGGAACTCGAGTTCCTCATTATGTTTAGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-847s1c1
Sequence:CCGGCCAGGATTTGAGAAGCGCTTACTCGAGTAAGCGCTTCTCAAATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-516s1c1
Sequence:CCGGGCAGAAGAATTGGGTCGAATTCTCGAGAATTCGACCCAATTCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181420
FN3KRP MISSION shRNA shRNA Plasmid DNA
fructosamine 3 kinase related protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1150s21c1
Sequence:CCGGGTGACCTGACTCCAACGATTTCTCGAGAAATCGTTGGAGTCAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1093s21c1
Sequence:CCGGGATCAAGTCTTAGCATCATACCTCGAGGTATGATGCTAAGACTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-827s21c1
Sequence:CCGGTGGCAATAGCGGGCATGTTTGCTCGAGCAAACATGCCCGCTATTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-176s21c1
Sequence:CCGGAGAGTTATGACACGGACAAAGCTCGAGCTTTGTCCGTGTCATAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-120s1c1
Sequence:CCGGCCAGAGTTATGACACGGACAACTCGAGTTGTCCGTGTCATAACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-301s1c1
Sequence:CCGGGAGCATTTGGACATGCGGTATCTCGAGATACCGCATGTCCAAATGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-933s1c1
Sequence:CCGGCTCTCTAAACATAATGAGGAACTCGAGTTCCTCATTATGTTTAGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-847s1c1
Sequence:CCGGCCAGGATTTGAGAAGCGCTTACTCGAGTAAGCGCTTCTCAAATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-516s1c1
Sequence:CCGGGCAGAAGAATTGGGTCGAATTCTCGAGAATTCGACCCAATTCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181420
FN3KRP MISSION shRNA Lentiviral Transduction Particles
fructosamine 3 kinase related protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1150s21c1
Sequence:CCGGGTGACCTGACTCCAACGATTTCTCGAGAAATCGTTGGAGTCAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181420.3-1093s21c1
Sequence:CCGGGATCAAGTCTTAGCATCATACCTCGAGGTATGATGCTAAGACTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-827s21c1
Sequence:CCGGTGGCAATAGCGGGCATGTTTGCTCGAGCAAACATGCCCGCTATTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181420.3-176s21c1
Sequence:CCGGAGAGTTATGACACGGACAAAGCTCGAGCTTTGTCCGTGTCATAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-120s1c1
Sequence:CCGGCCAGAGTTATGACACGGACAACTCGAGTTGTCCGTGTCATAACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-301s1c1
Sequence:CCGGGAGCATTTGGACATGCGGTATCTCGAGATACCGCATGTCCAAATGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-933s1c1
Sequence:CCGGCTCTCTAAACATAATGAGGAACTCGAGTTCCTCATTATGTTTAGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-847s1c1
Sequence:CCGGCCAGGATTTGAGAAGCGCTTACTCGAGTAAGCGCTTCTCAAATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181420.2-516s1c1
Sequence:CCGGGCAGAAGAATTGGGTCGAATTCTCGAGAATTCGACCCAATTCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024619
VALIDATED
FN3KRP MISSION shRNA Bacterial Glycerol Stock
fructosamine 3 kinase related protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-129s1c2
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-111s1c2
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-449s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1174s1c1
Sequence:CCGGGTATGAGCAGAGGGATGTATGCTCGAGCATACATCCCTCTGCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1035s1c1
Sequence:CCGGCGGACTAGCTTAAGACCAATGCTCGAGCATTGGTCTTAAGCTAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1456s1c1
Sequence:CCGGCAATTCCAGAATCAAGCGTATCTCGAGATACGCTTGATTCTGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1402s1c1
Sequence:CCGGGCAAGACTTGGGTGTAGATATCTCGAGATATCTACACCCAAGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-749s1c1
Sequence:CCGGCTCGGAATATGAGCTGGCAATCTCGAGATTGCCAGCTCATATTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-111s1c1
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-881s1c1
Sequence:CCGGCTTGAACCACTGGAATCATTTCTCGAGAAATGATTCCAGTGGTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-346s1c1
Sequence:CCGGTGGCCGATTTACACCTTGATACTCGAGTATCAAGGTGTAAATCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-129s1c1
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024619
VALIDATED
FN3KRP MISSION shRNA shRNA Plasmid DNA
fructosamine 3 kinase related protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-129s1c2
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-111s1c2
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-449s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1174s1c1
Sequence:CCGGGTATGAGCAGAGGGATGTATGCTCGAGCATACATCCCTCTGCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1035s1c1
Sequence:CCGGCGGACTAGCTTAAGACCAATGCTCGAGCATTGGTCTTAAGCTAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1456s1c1
Sequence:CCGGCAATTCCAGAATCAAGCGTATCTCGAGATACGCTTGATTCTGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1402s1c1
Sequence:CCGGGCAAGACTTGGGTGTAGATATCTCGAGATATCTACACCCAAGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-749s1c1
Sequence:CCGGCTCGGAATATGAGCTGGCAATCTCGAGATTGCCAGCTCATATTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-111s1c1
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-881s1c1
Sequence:CCGGCTTGAACCACTGGAATCATTTCTCGAGAAATGATTCCAGTGGTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-346s1c1
Sequence:CCGGTGGCCGATTTACACCTTGATACTCGAGTATCAAGGTGTAAATCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-129s1c1
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024619
VALIDATED
FN3KRP MISSION shRNA Lentiviral Transduction Particles
fructosamine 3 kinase related protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-129s1c2
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-111s1c2
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-449s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1174s1c1
Sequence:CCGGGTATGAGCAGAGGGATGTATGCTCGAGCATACATCCCTCTGCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1035s1c1
Sequence:CCGGCGGACTAGCTTAAGACCAATGCTCGAGCATTGGTCTTAAGCTAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024619.2-1456s1c1
Sequence:CCGGCAATTCCAGAATCAAGCGTATCTCGAGATACGCTTGATTCTGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-1402s1c1
Sequence:CCGGGCAAGACTTGGGTGTAGATATCTCGAGATATCTACACCCAAGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-749s1c1
Sequence:CCGGCTCGGAATATGAGCTGGCAATCTCGAGATTGCCAGCTCATATTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-111s1c1
Sequence:CCGGCGGAGCTACGACACGGATCAACTCGAGTTGATCCGTGTCGTAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-881s1c1
Sequence:CCGGCTTGAACCACTGGAATCATTTCTCGAGAAATGATTCCAGTGGTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024619.2-346s1c1
Sequence:CCGGTGGCCGATTTACACCTTGATACTCGAGTATCAAGGTGTAAATCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024619.2-129s1c1
Sequence:CCGGCAAGGACGAGTGTTCGTGAAACTCGAGTTTCACGAACACTCGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)