EMAIL THIS PAGE TO A FRIEND

FNIP1

folliculin interacting protein 1

202 Gene Product Result for
UniProtKB ID: Q8TF40, D6RJH5, Q86T47, Q9BUT0
Gene ID:
Mouse(216742) folliculin interacting protein 1
Rat(100362347) folliculin interacting protein 1
chicken(427642) folliculin interacting protein 1
dog(481496) folliculin interacting protein 1
domestic cat(101093329) folliculin interacting protein 1
Horse(100072917) folliculin interacting protein 1
cow(523042) folliculin interacting protein 1
sheep(101123298) folliculin interacting protein 1
naked mole-rat(101696429) folliculin interacting protein 1
domestic guinea pig(100717527) folliculin interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133372 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU050901 MISSION® esiRNA esiRNA targeting mouse Fnip1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008738 Rosetta Predictions human pricing
NM_133372 Rosetta Predictions human pricing
NM_173753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013890 predicted 2902
2 SASI_Hs02_00305549 predicted 1344
3 SASI_Hs01_00013891 predicted 2598
4 SASI_Hs01_00013893 predicted 2464
5 SASI_Hs02_00305550 predicted 3305
6 SASI_Hs01_00013894 predicted 1229
7 SASI_Hs01_00013896 predicted 2922
8 SASI_Hs01_00013897 predicted 1162
9 SASI_Hs02_00305551 predicted 2504
10 SASI_Hs02_00305552 predicted 391
11 SASI_Hs01_00013892 predicted 1560
12 SASI_Hs01_00013895 predicted 3216
13 SASI_Hs01_00013898 predicted 1696
14 SASI_Hs01_00013899 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190926 predicted 2986
2 SASI_Hs02_00363071 predicted 1426
3 SASI_Hs01_00190927 predicted 2673
4 SASI_Hs01_00190929 predicted 2550
5 SASI_Hs02_00363072 predicted 3386
6 SASI_Hs01_00190930 predicted 1308
7 SASI_Hs01_00190932 predicted 3001
8 SASI_Hs01_00190933 predicted 1243
9 SASI_Hs02_00363073 predicted 2591
10 SASI_Hs02_00363074 predicted 394
11 SASI_Hs01_00190928 predicted 1647
12 SASI_Hs01_00190931 predicted 3301
13 SASI_Hs01_00190934 predicted 1776
14 SASI_Hs01_00190935 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043531 predicted 2144
2 SASI_Mm01_00043532 predicted 3247
3 SASI_Mm01_00043533 predicted 2340
4 SASI_Mm01_00043534 predicted 1210
5 SASI_Mm01_00043535 predicted 2643
6 SASI_Mm01_00043537 predicted 210
7 SASI_Mm01_00043538 predicted 689
8 SASI_Mm01_00043539 predicted 3249
9 SASI_Mm01_00043540 predicted 2299
10 SASI_Mm02_00345398 predicted 3701
11 SASI_Mm01_00043536 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173753
VALIDATED
FNIP1 MISSION shRNA Bacterial Glycerol Stock
folliculin interacting protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-6100s1c1
Sequence:CCGGCCTCTGAGAATGTTCTGCTTTCTCGAGAAAGCAGAACATTCTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2363s1c1
Sequence:CCGGCGTTCTTGATTGGAGATTCTACTCGAGTAGAATCTCCAATCAAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2359s1c1
Sequence:CCGGGTTACGTTCTTGATTGGAGATCTCGAGATCTCCAATCAAGAACGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-5381s1c1
Sequence:CCGGGCTCTGTTGTATTCTGTTGAACTCGAGTTCAACAGAATACAACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173753
VALIDATED
FNIP1 MISSION shRNA shRNA Plasmid DNA
folliculin interacting protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-6100s1c1
Sequence:CCGGCCTCTGAGAATGTTCTGCTTTCTCGAGAAAGCAGAACATTCTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2363s1c1
Sequence:CCGGCGTTCTTGATTGGAGATTCTACTCGAGTAGAATCTCCAATCAAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2359s1c1
Sequence:CCGGGTTACGTTCTTGATTGGAGATCTCGAGATCTCCAATCAAGAACGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-5381s1c1
Sequence:CCGGGCTCTGTTGTATTCTGTTGAACTCGAGTTCAACAGAATACAACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173753
VALIDATED
FNIP1 MISSION shRNA Lentiviral Transduction Particles
folliculin interacting protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-6100s1c1
Sequence:CCGGCCTCTGAGAATGTTCTGCTTTCTCGAGAAAGCAGAACATTCTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2363s1c1
Sequence:CCGGCGTTCTTGATTGGAGATTCTACTCGAGTAGAATCTCCAATCAAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-2359s1c1
Sequence:CCGGGTTACGTTCTTGATTGGAGATCTCGAGATCTCCAATCAAGAACGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173753.3-5381s1c1
Sequence:CCGGGCTCTGTTGTATTCTGTTGAACTCGAGTTCAACAGAATACAACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133372
VALIDATED
FNIP1 MISSION shRNA Bacterial Glycerol Stock
folliculin interacting protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133372.1-5863s1c1
Sequence:CCGGGCTGGGAAGGAAATGACCTATCTCGAGATAGGTCATTTCCTTCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-3228s1c1
Sequence:CCGGGCAGAAGCTGTCTGTATTATACTCGAGTATAATACAGACAGCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-2883s1c1
Sequence:CCGGGAATGGGACATTCCAAGAAATCTCGAGATTTCTTGGAATGTCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-1379s1c1
Sequence:CCGGGAACCACCTTTGCTATCGTTTCTCGAGAAACGATAGCAAAGGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-2172s1c1
Sequence:CCGGGCATTGTCAGAGTCAGGCTTACTCGAGTAAGCCTGACTCTGACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-1509s1c1
Sequence:CCGGCCAAATGGACAACCACCTATACTCGAGTATAGGTGGTTGTCCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-214s1c1
Sequence:CCGGGCCAGATTCGACTGATTGTATCTCGAGATACAATCAGTCGAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-2637s21c1
Sequence:CCGGTGAGCTTATTCGACGAATATTCTCGAGAATATTCGTCGAATAAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133372.2-1732s21c1
Sequence:CCGGCATGGTCCAGAGGCTACTTTACTCGAGTAAAGTAGCCTCTGGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133372.2-5233s21c1
Sequence:CCGGTTTACCTAGTCCCAGTTATTACTCGAGTAATAACTGGGACTAGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1316s21c1
Sequence:CCGGCGAATAGTTGATGCCCTAAATCTCGAGATTTAGGGCATCAACTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1621s21c1
Sequence:CCGGGGCAAAGACTCATCCATATAACTCGAGTTATATGGATGAGTCTTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133372
VALIDATED
FNIP1 MISSION shRNA shRNA Plasmid DNA
folliculin interacting protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133372.1-5863s1c1
Sequence:CCGGGCTGGGAAGGAAATGACCTATCTCGAGATAGGTCATTTCCTTCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-3228s1c1
Sequence:CCGGGCAGAAGCTGTCTGTATTATACTCGAGTATAATACAGACAGCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-2883s1c1
Sequence:CCGGGAATGGGACATTCCAAGAAATCTCGAGATTTCTTGGAATGTCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-1379s1c1
Sequence:CCGGGAACCACCTTTGCTATCGTTTCTCGAGAAACGATAGCAAAGGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-2172s1c1
Sequence:CCGGGCATTGTCAGAGTCAGGCTTACTCGAGTAAGCCTGACTCTGACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-1509s1c1
Sequence:CCGGCCAAATGGACAACCACCTATACTCGAGTATAGGTGGTTGTCCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-214s1c1
Sequence:CCGGGCCAGATTCGACTGATTGTATCTCGAGATACAATCAGTCGAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-2637s21c1
Sequence:CCGGTGAGCTTATTCGACGAATATTCTCGAGAATATTCGTCGAATAAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133372.2-1732s21c1
Sequence:CCGGCATGGTCCAGAGGCTACTTTACTCGAGTAAAGTAGCCTCTGGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133372.2-5233s21c1
Sequence:CCGGTTTACCTAGTCCCAGTTATTACTCGAGTAATAACTGGGACTAGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1316s21c1
Sequence:CCGGCGAATAGTTGATGCCCTAAATCTCGAGATTTAGGGCATCAACTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1621s21c1
Sequence:CCGGGGCAAAGACTCATCCATATAACTCGAGTTATATGGATGAGTCTTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133372
VALIDATED
FNIP1 MISSION shRNA Lentiviral Transduction Particles
folliculin interacting protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133372.1-5863s1c1
Sequence:CCGGGCTGGGAAGGAAATGACCTATCTCGAGATAGGTCATTTCCTTCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-3228s1c1
Sequence:CCGGGCAGAAGCTGTCTGTATTATACTCGAGTATAATACAGACAGCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-2883s1c1
Sequence:CCGGGAATGGGACATTCCAAGAAATCTCGAGATTTCTTGGAATGTCCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133372.1-1379s1c1
Sequence:CCGGGAACCACCTTTGCTATCGTTTCTCGAGAAACGATAGCAAAGGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-2172s1c1
Sequence:CCGGGCATTGTCAGAGTCAGGCTTACTCGAGTAAGCCTGACTCTGACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133372.1-1509s1c1
Sequence:CCGGCCAAATGGACAACCACCTATACTCGAGTATAGGTGGTTGTCCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_133372.1-214s1c1
Sequence:CCGGGCCAGATTCGACTGATTGTATCTCGAGATACAATCAGTCGAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-2637s21c1
Sequence:CCGGTGAGCTTATTCGACGAATATTCTCGAGAATATTCGTCGAATAAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133372.2-1732s21c1
Sequence:CCGGCATGGTCCAGAGGCTACTTTACTCGAGTAAAGTAGCCTCTGGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133372.2-5233s21c1
Sequence:CCGGTTTACCTAGTCCCAGTTATTACTCGAGTAATAACTGGGACTAGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1316s21c1
Sequence:CCGGCGAATAGTTGATGCCCTAAATCTCGAGATTTAGGGCATCAACTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_133372.2-1621s21c1
Sequence:CCGGGGCAAAGACTCATCCATATAACTCGAGTTATATGGATGAGTCTTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)