EMAIL THIS PAGE TO A FRIEND

FOXB1

forkhead box B1

48 Gene Product Result for
Synonyms: FKH5 HFKH-5
UniProtKB ID: Q99853, O60652, O75917, Q14CL2
Gene ID:
Mouse(64290) forkhead box B1
Rat(367106) forkhead box B1
naked mole-rat(101723863) forkhead box B1
sheep(101114446) forkhead box B1
chicken(100859030) forkhead box B1
dog(100685913) forkhead box B1
domestic cat(101100643) forkhead box B1
cow(539181) forkhead box B1
dog(487582) forkhead box B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501534 Anti-FOXB1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine, bovine, pig, rat
ELISA, immunocytochemistry pricing
AV38961 Anti-FOXB1 antibody produced in rabbit IgG fraction of antiserum canine, mouse, guinea pig, horse, rabbit, bovine, rat, zebrafish, human
western blot pricing
SAB2100837 Anti-FOXB1 antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, bovine, mouse
western blot pricing
SAB2104254 Anti-FOXB1 antibody produced in rabbit affinity isolated antibody zebrafish, horse, human, canine, guinea pig, rat, mouse
western blot pricing
SAB4501184 Anti-FOXB1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA073369 Anti-FOXB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012182 Rosetta Predictions human pricing
NM_001013248 Rosetta Predictions rat pricing
NM_022378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173836 predicted 793
2 SASI_Hs01_00173837 predicted 792
3 SASI_Hs01_00173838 predicted 1204
4 SASI_Hs01_00173845 predicted 625
5 SASI_Hs01_00173839 predicted 1234
6 SASI_Hs01_00173840 predicted 917
7 SASI_Hs02_00343796 predicted 558
8 SASI_Hs02_00343797 predicted 1123
9 SASI_Hs02_00343798 predicted 494
10 SASI_Hs02_00343799 predicted 1138
11 SASI_Hs01_00173841 predicted 689
12 SASI_Hs01_00173842 predicted 676
13 SASI_Hs01_00173843 predicted 545
14 SASI_Hs01_00173844 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042957 predicted 728
2 SASI_Rn01_00042958 predicted 737
3 SASI_Rn01_00042959 predicted 318
4 SASI_Rn01_00042960 predicted 570
5 SASI_Rn01_00042961 predicted 312
6 SASI_Rn01_00042962 predicted 374
7 SASI_Rn01_00042963 predicted 380
8 SASI_Rn01_00042964 predicted 447
9 SASI_Rn01_00042966 predicted 447
10 SASI_Rn02_00201074 predicted 435
11 SASI_Rn01_00042965 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111293 predicted 1030
2 SASI_Mm01_00111294 predicted 1520
3 SASI_Mm01_00111295 predicted 763
4 SASI_Mm01_00111296 predicted 529
5 SASI_Mm01_00111297 predicted 1040
6 SASI_Mm01_00111298 predicted 1026
7 SASI_Mm01_00111299 predicted 1152
8 SASI_Mm01_00111300 predicted 940
9 SASI_Mm01_00111301 predicted 1047
10 SASI_Mm01_00111302 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022378
FOXB1 MISSION shRNA Bacterial Glycerol Stock
forkhead box B1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1578s21c1
Sequence:CCGGACCAGAAGACAAACCACAAACCTCGAGGTTTGTGGTTTGTCTTCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-650s21c1
Sequence:CCGGACGATTGCTTCATCAAGATCCCTCGAGGGATCTTGATGAAGCAATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-551s21c1
Sequence:CCGGCGCTCAGCGAGATCTACAAGTCTCGAGACTTGTAGATCTCGCTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-973s21c1
Sequence:CCGGATCGCTAGGGAGTACAAGATGCTCGAGCATCTTGTACTCCCTAGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1844s21c1
Sequence:CCGGGCTCTGGACTCTGCGCAATTTCTCGAGAAATTGCGCAGAGTCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022378.2-1432s1c1
Sequence:CCGGCCTCGCTCTTAGAAGAACTTTCTCGAGAAAGTTCTTCTAAGAGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-833s1c1
Sequence:CCGGGCATCCCTTTGCTATCGAGAACTCGAGTTCTCGATAGCAAAGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-836s1c1
Sequence:CCGGTCCCTTTGCTATCGAGAACATCTCGAGATGTTCTCGATAGCAAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-826s1c1
Sequence:CCGGGCTTCAAGCATCCCTTTGCTACTCGAGTAGCAAAGGGATGCTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-932s1c1
Sequence:CCGGCCCTAACCAGTTAACTACCATCTCGAGATGGTAGTTAACTGGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022378
FOXB1 MISSION shRNA shRNA Plasmid DNA
forkhead box B1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1578s21c1
Sequence:CCGGACCAGAAGACAAACCACAAACCTCGAGGTTTGTGGTTTGTCTTCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-650s21c1
Sequence:CCGGACGATTGCTTCATCAAGATCCCTCGAGGGATCTTGATGAAGCAATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-551s21c1
Sequence:CCGGCGCTCAGCGAGATCTACAAGTCTCGAGACTTGTAGATCTCGCTGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-973s21c1
Sequence:CCGGATCGCTAGGGAGTACAAGATGCTCGAGCATCTTGTACTCCCTAGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1844s21c1
Sequence:CCGGGCTCTGGACTCTGCGCAATTTCTCGAGAAATTGCGCAGAGTCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022378.2-1432s1c1
Sequence:CCGGCCTCGCTCTTAGAAGAACTTTCTCGAGAAAGTTCTTCTAAGAGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-833s1c1
Sequence:CCGGGCATCCCTTTGCTATCGAGAACTCGAGTTCTCGATAGCAAAGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-836s1c1
Sequence:CCGGTCCCTTTGCTATCGAGAACATCTCGAGATGTTCTCGATAGCAAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-826s1c1
Sequence:CCGGGCTTCAAGCATCCCTTTGCTACTCGAGTAGCAAAGGGATGCTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-932s1c1
Sequence:CCGGCCCTAACCAGTTAACTACCATCTCGAGATGGTAGTTAACTGGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022378
FOXB1 MISSION shRNA Lentiviral Transduction Particles
forkhead box B1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1578s21c1
Sequence:CCGGACCAGAAGACAAACCACAAACCTCGAGGTTTGTGGTTTGTCTTCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-650s21c1
Sequence:CCGGACGATTGCTTCATCAAGATCCCTCGAGGGATCTTGATGAAGCAATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-551s21c1
Sequence:CCGGCGCTCAGCGAGATCTACAAGTCTCGAGACTTGTAGATCTCGCTGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022378.3-973s21c1
Sequence:CCGGATCGCTAGGGAGTACAAGATGCTCGAGCATCTTGTACTCCCTAGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022378.3-1844s21c1
Sequence:CCGGGCTCTGGACTCTGCGCAATTTCTCGAGAAATTGCGCAGAGTCCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022378.2-1432s1c1
Sequence:CCGGCCTCGCTCTTAGAAGAACTTTCTCGAGAAAGTTCTTCTAAGAGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-833s1c1
Sequence:CCGGGCATCCCTTTGCTATCGAGAACTCGAGTTCTCGATAGCAAAGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-836s1c1
Sequence:CCGGTCCCTTTGCTATCGAGAACATCTCGAGATGTTCTCGATAGCAAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-826s1c1
Sequence:CCGGGCTTCAAGCATCCCTTTGCTACTCGAGTAGCAAAGGGATGCTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022378.2-932s1c1
Sequence:CCGGCCCTAACCAGTTAACTACCATCTCGAGATGGTAGTTAACTGGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012182
FOXB1 MISSION shRNA Bacterial Glycerol Stock
forkhead box B1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-556s21c1
Sequence:CCGGTCCAGAGCTCTCCCGAGAAGACTCGAGTCTTCTCGGGAGAGCTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-624s21c1
Sequence:CCGGTACTACAGGGAGAACACGCAGCTCGAGCTGCGTGTTCTCCCTGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-77s1c1
Sequence:CCGGCGTACATCTCGCTGACCGCTACTCGAGTAGCGGTCAGCGAGATGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-138s1c1
Sequence:CCGGCGAGATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-579s1c1
Sequence:CCGGGCTGGCCTTCTCCGCCATGCACTCGAGTGCATGGCGGAGAAGGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-345s1c1
Sequence:CCGGCAAGCGCTTCAAGGTGCTTAACTCGAGTTAAGCACCTTGAAGCGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012182
FOXB1 MISSION shRNA shRNA Plasmid DNA
forkhead box B1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-556s21c1
Sequence:CCGGTCCAGAGCTCTCCCGAGAAGACTCGAGTCTTCTCGGGAGAGCTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-624s21c1
Sequence:CCGGTACTACAGGGAGAACACGCAGCTCGAGCTGCGTGTTCTCCCTGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-77s1c1
Sequence:CCGGCGTACATCTCGCTGACCGCTACTCGAGTAGCGGTCAGCGAGATGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-138s1c1
Sequence:CCGGCGAGATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-579s1c1
Sequence:CCGGGCTGGCCTTCTCCGCCATGCACTCGAGTGCATGGCGGAGAAGGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-345s1c1
Sequence:CCGGCAAGCGCTTCAAGGTGCTTAACTCGAGTTAAGCACCTTGAAGCGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012182
FOXB1 MISSION shRNA Lentiviral Transduction Particles
forkhead box B1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-556s21c1
Sequence:CCGGTCCAGAGCTCTCCCGAGAAGACTCGAGTCTTCTCGGGAGAGCTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012182.2-624s21c1
Sequence:CCGGTACTACAGGGAGAACACGCAGCTCGAGCTGCGTGTTCTCCCTGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-77s1c1
Sequence:CCGGCGTACATCTCGCTGACCGCTACTCGAGTAGCGGTCAGCGAGATGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-138s1c1
Sequence:CCGGCGAGATCTACAAGTTCATCATCTCGAGATGATGAACTTGTAGATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-579s1c1
Sequence:CCGGGCTGGCCTTCTCCGCCATGCACTCGAGTGCATGGCGGAGAAGGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012182.1-345s1c1
Sequence:CCGGCAAGCGCTTCAAGGTGCTTAACTCGAGTTAAGCACCTTGAAGCGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)