EMAIL THIS PAGE TO A FRIEND

FOXC2

forkhead box C2 (MFH-1, mesenchyme forkhead 1)

55 Gene Product Result for
Synonyms: FKHL14 LD MFH-1 MFH1
UniProtKB ID: Q99958, C6KMR9, Q14DA6
Gene ID:
Human(2303) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
Mouse(14234) forkhead box C2
Rat(171356) forkhead box C2
chicken(396039) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
dog(489671) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
cow(507300) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Horse(100036555) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
sheep(101103500) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
domestic guinea pig(100734751) forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31703 Anti-FOXC2 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, horse, guinea pig, human, mouse, canine, bovine
western blot pricing
AV32307 Anti-FOXC2 (AB2) antibody produced in rabbit IgG fraction of antiserum human, horse, mouse, canine
western blot pricing
SAB2500411 Anti-FOXC2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412035 ANTI-FOXC2 antibody produced in mouse clone 3H3, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412342 ANTI-FOXC2 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412343 ANTI-FOXC2 antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412344 ANTI-FOXC2 antibody produced in mouse clone 3E6, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412345 ANTI-FOXC2 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412346 ANTI-FOXC2 antibody produced in mouse clone 4A3, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412479 ANTI-FOXC2 antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
F1054 Anti-FOXC2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
microarray, western blot pricing
SAB2106499 Anti-FOXC2 antibody produced in rabbit affinity isolated antibody mouse, horse, guinea pig
ELISA, western blot pricing
HPA056302 Anti-FOXC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0002303M2 Monoclonal Anti-FOXC2 antibody produced in mouse clone 2H3, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403826 Monoclonal Anti-FOXC2, (C-terminal) antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005251 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005251 Rosetta Predictions human pricing
NM_001101680 Rosetta Predictions rat pricing
NM_013519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026297 predicted 1337
2 SASI_Hs01_00026298 predicted 41
3 SASI_Hs01_00026299 predicted 1402
4 SASI_Hs01_00026300 predicted 192
5 SASI_Hs01_00026301 predicted 1344
6 SASI_Hs01_00026302 predicted 159
7 SASI_Hs01_00026303 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211364 predicted 2376
2 SASI_Rn02_00211365 predicted 2377
3 SASI_Rn02_00211366 predicted 1874
4 SASI_Rn02_00211367 predicted 830
5 SASI_Rn02_00211368 predicted 463
6 SASI_Rn02_00211369 predicted 2343
7 SASI_Rn02_00211370 predicted 727
8 SASI_Rn02_00211371 predicted 629
9 SASI_Rn02_00211372 predicted 2371
10 SASI_Rn02_00211373 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322206 predicted 1895
2 SASI_Mm02_00322207 predicted 486
3 SASI_Mm01_00174361 predicted 2406
4 SASI_Mm01_00174362 predicted 1902
5 SASI_Mm02_00322208 predicted 448
6 SASI_Mm02_00322209 predicted 2398
7 SASI_Mm01_00174363 predicted 809
8 SASI_Mm02_00322210 predicted 2400
9 SASI_Mm02_00322211 predicted 2277
10 SASI_Mm01_00174360 predicted 1056
11 SASI_Mm01_00174364 predicted 1983
12 SASI_Mm01_00174365 predicted 1959
13 SASI_Mm01_00174366 predicted 650
14 SASI_Mm01_00174367 predicted 398
15 SASI_Mm01_00174368 predicted 650
16 SASI_Mm01_00174369 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013519
VALIDATED
FOXC2 MISSION shRNA Bacterial Glycerol Stock
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-74s1c1
Sequence:CCGGGTACCCTATTTGAGTGAGCAACTCGAGTTGCTCACTCAAATAGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-1012s1c1
Sequence:CCGGCCAGTGCAGTATGCGGGCTATCTCGAGATAGCCCGCATACTGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013519.1-1894s1c1
Sequence:CCGGGCGGATTTGTAACCAGGCTATCTCGAGATAGCCTGGTTACAAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-645s1c1
Sequence:CCGGCCGAGAAGAAAGTCGTGGTTACTCGAGTAACCACGACTTTCTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-401s1c1
Sequence:CCGGCTCAATGAGTGCTTCGTGAAACTCGAGTTTCACGAAGCACTCATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013519.2-2057s21c1
Sequence:CCGGTGCAACTCGCAGGTAACTTATCTCGAGATAAGTTACCTGCGAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1770s21c1
Sequence:CCGGCAACGTCCGGGAGATGTTCAACTCGAGTTGAACATCTCCCGGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013519.2-2272s21c1
Sequence:CCGGCAAGAGGTCTCTCCGGATAAGCTCGAGCTTATCCGGAGAGACCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-818s21c1
Sequence:CCGGTCAATGAGTGCTTCGTGAAAGCTCGAGCTTTCACGAAGCACTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1062s21c1
Sequence:CCGGCGAGAAGAAAGTCGTGGTTAACTCGAGTTAACCACGACTTTCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1906s21c1
Sequence:CCGGTCTTACGACTGCACCAAATACCTCGAGGTATTTGGTGCAGTCGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-665s21c1
Sequence:CCGGACAGCTATATAGCGCTCATCACTCGAGTGATGAGCGCTATATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013519
VALIDATED
FOXC2 MISSION shRNA shRNA Plasmid DNA
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-74s1c1
Sequence:CCGGGTACCCTATTTGAGTGAGCAACTCGAGTTGCTCACTCAAATAGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-1012s1c1
Sequence:CCGGCCAGTGCAGTATGCGGGCTATCTCGAGATAGCCCGCATACTGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013519.1-1894s1c1
Sequence:CCGGGCGGATTTGTAACCAGGCTATCTCGAGATAGCCTGGTTACAAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-645s1c1
Sequence:CCGGCCGAGAAGAAAGTCGTGGTTACTCGAGTAACCACGACTTTCTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-401s1c1
Sequence:CCGGCTCAATGAGTGCTTCGTGAAACTCGAGTTTCACGAAGCACTCATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013519.2-2057s21c1
Sequence:CCGGTGCAACTCGCAGGTAACTTATCTCGAGATAAGTTACCTGCGAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1770s21c1
Sequence:CCGGCAACGTCCGGGAGATGTTCAACTCGAGTTGAACATCTCCCGGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013519.2-2272s21c1
Sequence:CCGGCAAGAGGTCTCTCCGGATAAGCTCGAGCTTATCCGGAGAGACCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-818s21c1
Sequence:CCGGTCAATGAGTGCTTCGTGAAAGCTCGAGCTTTCACGAAGCACTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1062s21c1
Sequence:CCGGCGAGAAGAAAGTCGTGGTTAACTCGAGTTAACCACGACTTTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1906s21c1
Sequence:CCGGTCTTACGACTGCACCAAATACCTCGAGGTATTTGGTGCAGTCGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-665s21c1
Sequence:CCGGACAGCTATATAGCGCTCATCACTCGAGTGATGAGCGCTATATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013519
VALIDATED
FOXC2 MISSION shRNA Lentiviral Transduction Particles
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-74s1c1
Sequence:CCGGGTACCCTATTTGAGTGAGCAACTCGAGTTGCTCACTCAAATAGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-1012s1c1
Sequence:CCGGCCAGTGCAGTATGCGGGCTATCTCGAGATAGCCCGCATACTGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013519.1-1894s1c1
Sequence:CCGGGCGGATTTGTAACCAGGCTATCTCGAGATAGCCTGGTTACAAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-645s1c1
Sequence:CCGGCCGAGAAGAAAGTCGTGGTTACTCGAGTAACCACGACTTTCTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013519.1-401s1c1
Sequence:CCGGCTCAATGAGTGCTTCGTGAAACTCGAGTTTCACGAAGCACTCATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013519.2-2057s21c1
Sequence:CCGGTGCAACTCGCAGGTAACTTATCTCGAGATAAGTTACCTGCGAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1770s21c1
Sequence:CCGGCAACGTCCGGGAGATGTTCAACTCGAGTTGAACATCTCCCGGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013519.2-2272s21c1
Sequence:CCGGCAAGAGGTCTCTCCGGATAAGCTCGAGCTTATCCGGAGAGACCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-818s21c1
Sequence:CCGGTCAATGAGTGCTTCGTGAAAGCTCGAGCTTTCACGAAGCACTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1062s21c1
Sequence:CCGGCGAGAAGAAAGTCGTGGTTAACTCGAGTTAACCACGACTTTCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-1906s21c1
Sequence:CCGGTCTTACGACTGCACCAAATACCTCGAGGTATTTGGTGCAGTCGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013519.2-665s21c1
Sequence:CCGGACAGCTATATAGCGCTCATCACTCGAGTGATGAGCGCTATATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005251
FOXC2 MISSION shRNA Bacterial Glycerol Stock
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-987s1c1
Sequence:CCGGCCAGTGCAGCATGCGAGCGATCTCGAGATCGCTCGCATGCTGCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-818s1c1
Sequence:CCGGAGAACATCATGACCCTGCGAACTCGAGTTCGCAGGGTCATGATGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-1350s1c1
Sequence:CCGGGCGGGAGATGTTCAACTCCCACTCGAGTGGGAGTTGAACATCTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-266s1c1
Sequence:CCGGCCGAGAAGAAGATCACCTTGACTCGAGTCAAGGTGATCTTCTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-54s1c1
Sequence:CCGGCCTGAGCGAGCAGAATTACTACTCGAGTAGTAATTCTGCTCGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-462s21c1
Sequence:CCGGTCAACGAGTGCTTCGTCAAGGCTCGAGCCTTGACGAAGCACTCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-707s21c1
Sequence:CCGGGAGAAGAAGGTGGTGATCAAGCTCGAGCTTGATCACCACCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005251
FOXC2 MISSION shRNA shRNA Plasmid DNA
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-987s1c1
Sequence:CCGGCCAGTGCAGCATGCGAGCGATCTCGAGATCGCTCGCATGCTGCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-818s1c1
Sequence:CCGGAGAACATCATGACCCTGCGAACTCGAGTTCGCAGGGTCATGATGTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-1350s1c1
Sequence:CCGGGCGGGAGATGTTCAACTCCCACTCGAGTGGGAGTTGAACATCTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-266s1c1
Sequence:CCGGCCGAGAAGAAGATCACCTTGACTCGAGTCAAGGTGATCTTCTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-54s1c1
Sequence:CCGGCCTGAGCGAGCAGAATTACTACTCGAGTAGTAATTCTGCTCGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-462s21c1
Sequence:CCGGTCAACGAGTGCTTCGTCAAGGCTCGAGCCTTGACGAAGCACTCGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-707s21c1
Sequence:CCGGGAGAAGAAGGTGGTGATCAAGCTCGAGCTTGATCACCACCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005251
FOXC2 MISSION shRNA Lentiviral Transduction Particles
forkhead box C2 (MFH-1, mesenchyme forkhead 1)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-987s1c1
Sequence:CCGGCCAGTGCAGCATGCGAGCGATCTCGAGATCGCTCGCATGCTGCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-818s1c1
Sequence:CCGGAGAACATCATGACCCTGCGAACTCGAGTTCGCAGGGTCATGATGTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-1350s1c1
Sequence:CCGGGCGGGAGATGTTCAACTCCCACTCGAGTGGGAGTTGAACATCTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-266s1c1
Sequence:CCGGCCGAGAAGAAGATCACCTTGACTCGAGTCAAGGTGATCTTCTTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005251.1-54s1c1
Sequence:CCGGCCTGAGCGAGCAGAATTACTACTCGAGTAGTAATTCTGCTCGCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-462s21c1
Sequence:CCGGTCAACGAGTGCTTCGTCAAGGCTCGAGCCTTGACGAAGCACTCGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005251.2-707s21c1
Sequence:CCGGGAGAAGAAGGTGGTGATCAAGCTCGAGCTTGATCACCACCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)