EMAIL THIS PAGE TO A FRIEND

FOXD4

forkhead box D4

51 Gene Product Result for
Synonyms: FKHL9 FOXD4A FREAC-5 FREAC5
Species: Human FOXD4(2298), Mouse Foxd4(14237), Rat Foxd4(252886), naked mole-rat Foxd4(101698676), domestic guinea pig Foxd4(100728152)
UniProtKB ID: Q12950, B2RN05, B9EGL7, Q5VVK1, Q8WXT6
Gene ID:
Human(2298) Summary: This gene encodes a member of the forkhead/winged helix-box (FOX) family of transcription factors. FOX transcription factors play critical roles in the regulation of multiple processes including metabolism, cell proliferation and gene expression during ontogenesis. Mutations in this gene are associated with a complex phenotype consisting of dilated cardiomyopathy, obsessive-compulsive disorders, and suicidality. [provided by RefSeq, Mar 2012]
Mouse(14237) forkhead box D4
Rat(252886) forkhead box D4
naked mole-rat(101698676) forkhead box D4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_095746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_095746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_095746 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108201 MISSION® esiRNA esiRNA human FOXD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207305 Rosetta Predictions human pricing
XM_001055972 Rosetta Predictions rat pricing
XM_001078871 Rosetta Predictions rat pricing
NM_008022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195563 predicted 1361
2 SASI_Hs01_00195564 predicted 1486
3 SASI_Hs01_00195565 predicted 1834
4 SASI_Hs01_00195566 predicted 1934
5 SASI_Hs01_00195567 predicted 1713
6 SASI_Hs01_00195568 predicted 2016
7 SASI_Hs01_00195569 predicted 2018
8 SASI_Hs01_00195570 predicted 1967
9 SASI_Hs01_00195571 predicted 2089
10 SASI_Hs01_00195572 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281624 predicted 692
2 SASI_Rn02_00281625 predicted 1140
3 SASI_Rn02_00281626 predicted 525
4 SASI_Rn02_00281627 predicted 501
5 SASI_Rn02_00281628 predicted 1105
6 SASI_Rn02_00281629 predicted 724
7 SASI_Rn02_00281630 predicted 1066
8 SASI_Rn02_00281631 predicted 691
9 SASI_Rn02_00281632 predicted 1138
10 SASI_Rn02_00281633 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362300 predicted 692
2 SASI_Rn02_00362301 predicted 530
3 SASI_Rn02_00362302 predicted 506
4 SASI_Rn02_00362303 predicted 1102
5 SASI_Rn02_00362304 predicted 717
6 SASI_Rn02_00362305 predicted 1069
7 SASI_Rn02_00362306 predicted 699
8 SASI_Rn02_00362307 predicted 191
9 SASI_Rn02_00362308 predicted 715
10 SASI_Rn02_00362309 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137174 predicted 1943
2 SASI_Mm01_00137176 predicted 1972
3 SASI_Mm01_00137177 predicted 2099
4 SASI_Mm01_00137178 predicted 1637
5 SASI_Mm02_00312966 predicted 1578
6 SASI_Mm01_00137179 predicted 1639
7 SASI_Mm01_00137180 predicted 2043
8 SASI_Mm01_00137181 predicted 827
9 SASI_Mm01_00137182 predicted 1472
10 SASI_Mm01_00137183 predicted 1287
11 SASI_Mm01_00137175 predicted 2095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008022
FOXD4 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-576s1c1
Sequence:CCGGGAAGATGGAGATCAGACGGAACTCGAGTTCCGTCTGATCTCCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-854s1c1
Sequence:CCGGCAGCGGTATCTGCGCCTTCATCTCGAGATGAAGGCGCAGATACCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1292s1c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008022.1-1942s1c1
Sequence:CCGGGCGCACTAAGTCCTTCCAAATCTCGAGATTTGGAAGGACTTAGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1585s1c1
Sequence:CCGGCCGCAGGTTCCCGGACAATATCTCGAGATATTGTCCGGGAACCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-888s21c1
Sequence:CCGGCCCTATTACCGCCGTAAGTTCCTCGAGGAACTTACGGCGGTAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1292s21c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1586s21c1
Sequence:CCGGCGCAGGTTCCCGGACAATATTCTCGAGAATATTGTCCGGGAACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008022.1-1908s21c1
Sequence:CCGGGCTAGGCTTGTGCGTAGAAAGCTCGAGCTTTCTACGCACAAGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1662s21c1
Sequence:CCGGATTAGCTGCGCTCCCGGTAAACTCGAGTTTACCGGGAGCGCAGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008022
FOXD4 MISSION shRNA shRNA Plasmid DNA
forkhead box D4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-576s1c1
Sequence:CCGGGAAGATGGAGATCAGACGGAACTCGAGTTCCGTCTGATCTCCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-854s1c1
Sequence:CCGGCAGCGGTATCTGCGCCTTCATCTCGAGATGAAGGCGCAGATACCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1292s1c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008022.1-1942s1c1
Sequence:CCGGGCGCACTAAGTCCTTCCAAATCTCGAGATTTGGAAGGACTTAGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1585s1c1
Sequence:CCGGCCGCAGGTTCCCGGACAATATCTCGAGATATTGTCCGGGAACCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-888s21c1
Sequence:CCGGCCCTATTACCGCCGTAAGTTCCTCGAGGAACTTACGGCGGTAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1292s21c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1586s21c1
Sequence:CCGGCGCAGGTTCCCGGACAATATTCTCGAGAATATTGTCCGGGAACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008022.1-1908s21c1
Sequence:CCGGGCTAGGCTTGTGCGTAGAAAGCTCGAGCTTTCTACGCACAAGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1662s21c1
Sequence:CCGGATTAGCTGCGCTCCCGGTAAACTCGAGTTTACCGGGAGCGCAGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008022
FOXD4 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-576s1c1
Sequence:CCGGGAAGATGGAGATCAGACGGAACTCGAGTTCCGTCTGATCTCCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-854s1c1
Sequence:CCGGCAGCGGTATCTGCGCCTTCATCTCGAGATGAAGGCGCAGATACCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1292s1c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008022.1-1942s1c1
Sequence:CCGGGCGCACTAAGTCCTTCCAAATCTCGAGATTTGGAAGGACTTAGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008022.1-1585s1c1
Sequence:CCGGCCGCAGGTTCCCGGACAATATCTCGAGATATTGTCCGGGAACCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-888s21c1
Sequence:CCGGCCCTATTACCGCCGTAAGTTCCTCGAGGAACTTACGGCGGTAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1292s21c1
Sequence:CCGGCTATGGCGACAACCCTAGAAACTCGAGTTTCTAGGGTTGTCGCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1586s21c1
Sequence:CCGGCGCAGGTTCCCGGACAATATTCTCGAGAATATTGTCCGGGAACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008022.1-1908s21c1
Sequence:CCGGGCTAGGCTTGTGCGTAGAAAGCTCGAGCTTTCTACGCACAAGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008022.1-1662s21c1
Sequence:CCGGATTAGCTGCGCTCCCGGTAAACTCGAGTTTACCGGGAGCGCAGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_095746
FOXD4 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c2
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-414s1c1
Sequence:CCGGCGCCTTCATTAGTGACCGCTTCTCGAGAAGCGGTCACTAATGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-495s1c1
Sequence:CCGGGAACGACTGCTTCGTCAAGATCTCGAGATCTTGACGAAGCAGTCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c1
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-465s1c1
Sequence:CCGGGCAGAACAGCATCCGCCACAACTCGAGTTGTGGCGGATGCTGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_095746
FOXD4 MISSION shRNA shRNA Plasmid DNA
forkhead box D4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c2
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-414s1c1
Sequence:CCGGCGCCTTCATTAGTGACCGCTTCTCGAGAAGCGGTCACTAATGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-495s1c1
Sequence:CCGGGAACGACTGCTTCGTCAAGATCTCGAGATCTTGACGAAGCAGTCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c1
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-465s1c1
Sequence:CCGGGCAGAACAGCATCCGCCACAACTCGAGTTGTGGCGGATGCTGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_095746
FOXD4 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c2
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-414s1c1
Sequence:CCGGCGCCTTCATTAGTGACCGCTTCTCGAGAAGCGGTCACTAATGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-495s1c1
Sequence:CCGGGAACGACTGCTTCGTCAAGATCTCGAGATCTTGACGAAGCAGTCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-977s1c1
Sequence:CCGGCTCTTTCAGCATTGAGAGTATCTCGAGATACTCTCAATGCTGAAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095746.8-465s1c1
Sequence:CCGGGCAGAACAGCATCCGCCACAACTCGAGTTGTGGCGGATGCTGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)