EMAIL THIS PAGE TO A FRIEND

FOXN3

forkhead box N3

280 Gene Product Result for
Synonyms: C14orf116 CHES1 PRO1635
UniProtKB ID: O00409, Q96II7, Q9UIE7
Gene ID:
Human(1112) Summary: This gene is a member of the forkhead/winged helix transcription factor family. Checkpoints are eukaryotic DNA damage-inducible cell cycle arrests at G1 and G2. Checkpoint suppressor 1 suppresses multiple yeast checkpoint mutations including mec1, rad9, rad53 and dun1 by activating a MEC1-independent checkpoint pathway. Alternative splicing is observed at the locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(71375) forkhead box N3
Rat(314374) forkhead box N3
Zebrafish(692291) forkhead box N3
cow(505469) forkhead box N3
Horse(100052973) forkhead box N3
domestic cat(101093279) forkhead box N3
dog(610880) forkhead box N3
chicken(423402) forkhead box N3
naked mole-rat(101716185) forkhead box N3
sheep(101114708) forkhead box N3
Domestic Rabbit(100350285) forkhead box N3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0864 AQUA Peptide SPVVSGDTSP[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_127089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085471 Rosetta Predictions human pricing
NM_005197 Rosetta Predictions human pricing
NM_001108047 Rosetta Predictions rat pricing
NM_183186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317915 predicted 609
2 SASI_Hs02_00317916 predicted 2068
3 SASI_Hs02_00317917 predicted 2037
4 SASI_Hs02_00317918 predicted 619
5 SASI_Hs02_00317919 predicted 540
6 SASI_Hs02_00317920 predicted 1968
7 SASI_Hs02_00317921 predicted 2015
8 SASI_Hs02_00317922 predicted 1986
9 SASI_Hs02_00317923 predicted 1983
10 SASI_Hs02_00317924 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098378 predicted 733
2 SASI_Hs01_00098379 predicted 2120
3 SASI_Hs02_00339151 predicted 2097
4 SASI_Hs02_00339152 predicted 731
5 SASI_Hs01_00098383 predicted 655
6 SASI_Hs02_00339153 predicted 2024
7 SASI_Hs01_00098384 predicted 2067
8 SASI_Hs02_00339154 predicted 2034
9 SASI_Hs02_00339155 predicted 2039
10 SASI_Hs02_00339156 predicted 651
11 SASI_Hs01_00098376 predicted 1308
12 SASI_Hs01_00098377 predicted 1006
13 SASI_Hs01_00098380 predicted 1049
14 SASI_Hs01_00098381 predicted 2034
15 SASI_Hs01_00098382 predicted 954
16 SASI_Hs01_00098385 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234825 predicted 846
2 SASI_Rn02_00234826 predicted 738
3 SASI_Rn02_00234827 predicted 703
4 SASI_Rn02_00234828 predicted 710
5 SASI_Rn02_00234829 predicted 1055
6 SASI_Rn02_00234830 predicted 745
7 SASI_Rn02_00234831 predicted 676
8 SASI_Rn02_00234832 predicted 575
9 SASI_Rn02_00234833 predicted 1020
10 SASI_Rn02_00234834 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120243 predicted 596
2 SASI_Mm01_00120244 predicted 474
3 SASI_Mm01_00120245 predicted 447
4 SASI_Mm01_00120246 predicted 545
5 SASI_Mm01_00120247 predicted 622
6 SASI_Mm01_00120248 predicted 416
7 SASI_Mm01_00120249 predicted 559
8 SASI_Mm02_00350296 predicted 559
9 SASI_Mm02_00350297 predicted 306
10 SASI_Mm02_00350298 predicted 863
11 SASI_Mm01_00120240 predicted 529
12 SASI_Mm01_00120241 predicted 616
13 SASI_Mm01_00120242 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127089
VALIDATED
FOXN3 MISSION shRNA Bacterial Glycerol Stock
forkhead box N3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127089.2-2571s1c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127089.2-1019s1c1
Sequence:CCGGCAGTACCTTCTTCAAGAGAAACTCGAGTTTCTCTTGAAGAAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-766s1c1
Sequence:CCGGTCTTAGAACATTTCCCGTATTCTCGAGAATACGGGAAATGTTCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-686s1c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-1122s1c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127089
VALIDATED
FOXN3 MISSION shRNA shRNA Plasmid DNA
forkhead box N3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127089.2-2571s1c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127089.2-1019s1c1
Sequence:CCGGCAGTACCTTCTTCAAGAGAAACTCGAGTTTCTCTTGAAGAAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-766s1c1
Sequence:CCGGTCTTAGAACATTTCCCGTATTCTCGAGAATACGGGAAATGTTCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-686s1c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-1122s1c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127089
VALIDATED
FOXN3 MISSION shRNA Lentiviral Transduction Particles
forkhead box N3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127089.2-2571s1c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127089.2-1019s1c1
Sequence:CCGGCAGTACCTTCTTCAAGAGAAACTCGAGTTTCTCTTGAAGAAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-766s1c1
Sequence:CCGGTCTTAGAACATTTCCCGTATTCTCGAGAATACGGGAAATGTTCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-686s1c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127089.2-1122s1c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005197
FOXN3 MISSION shRNA Bacterial Glycerol Stock
forkhead box N3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-555s1c1
Sequence:CCGGCAACTGGATCTTGGAACATTTCTCGAGAAATGTTCCAAGATCCAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005197.1-1941s1c1
Sequence:CCGGGCAGGGATGTCAACGTCAATACTCGAGTATTGACGTTGACATCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-924s1c1
Sequence:CCGGCCCTGAGATACAAGCAGGTTTCTCGAGAAACCTGCTTGTATCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1224s1c1
Sequence:CCGGCCACTATGAGTTTGCCACCAACTCGAGTTGGTGGCAAACTCATAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1530s1c1
Sequence:CCGGCCGGTCCTGTTTGAATAACATCTCGAGATGTTATTCAAACAGGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-385s21c1
Sequence:CCGGCTCTGCCTGACATCCGATTAGCTCGAGCTAATCGGATGTCAGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-883s21c1
Sequence:CCGGCACACCCACACGTGTTCAATACTCGAGTATTGAACACGTGTGGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-606s21c1
Sequence:CCGGTCCTTCAGCTGCCTCATATTTCTCGAGAAATATGAGGCAGCTGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-1583s21c1
Sequence:CCGGGATCCGGTCCTGTTTGAATAACTCGAGTTATTCAAACAGGACCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005197.3-7086s21c1
Sequence:CCGGTCGATATGGTGAACCTATTAACTCGAGTTAATAGGTTCACCATATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005197
FOXN3 MISSION shRNA shRNA Plasmid DNA
forkhead box N3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-555s1c1
Sequence:CCGGCAACTGGATCTTGGAACATTTCTCGAGAAATGTTCCAAGATCCAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005197.1-1941s1c1
Sequence:CCGGGCAGGGATGTCAACGTCAATACTCGAGTATTGACGTTGACATCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-924s1c1
Sequence:CCGGCCCTGAGATACAAGCAGGTTTCTCGAGAAACCTGCTTGTATCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1224s1c1
Sequence:CCGGCCACTATGAGTTTGCCACCAACTCGAGTTGGTGGCAAACTCATAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1530s1c1
Sequence:CCGGCCGGTCCTGTTTGAATAACATCTCGAGATGTTATTCAAACAGGACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-385s21c1
Sequence:CCGGCTCTGCCTGACATCCGATTAGCTCGAGCTAATCGGATGTCAGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-883s21c1
Sequence:CCGGCACACCCACACGTGTTCAATACTCGAGTATTGAACACGTGTGGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-606s21c1
Sequence:CCGGTCCTTCAGCTGCCTCATATTTCTCGAGAAATATGAGGCAGCTGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-1583s21c1
Sequence:CCGGGATCCGGTCCTGTTTGAATAACTCGAGTTATTCAAACAGGACCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005197.3-7086s21c1
Sequence:CCGGTCGATATGGTGAACCTATTAACTCGAGTTAATAGGTTCACCATATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005197
FOXN3 MISSION shRNA Lentiviral Transduction Particles
forkhead box N3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-555s1c1
Sequence:CCGGCAACTGGATCTTGGAACATTTCTCGAGAAATGTTCCAAGATCCAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005197.1-1941s1c1
Sequence:CCGGGCAGGGATGTCAACGTCAATACTCGAGTATTGACGTTGACATCCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-924s1c1
Sequence:CCGGCCCTGAGATACAAGCAGGTTTCTCGAGAAACCTGCTTGTATCTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1224s1c1
Sequence:CCGGCCACTATGAGTTTGCCACCAACTCGAGTTGGTGGCAAACTCATAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005197.1-1530s1c1
Sequence:CCGGCCGGTCCTGTTTGAATAACATCTCGAGATGTTATTCAAACAGGACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-385s21c1
Sequence:CCGGCTCTGCCTGACATCCGATTAGCTCGAGCTAATCGGATGTCAGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-883s21c1
Sequence:CCGGCACACCCACACGTGTTCAATACTCGAGTATTGAACACGTGTGGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-606s21c1
Sequence:CCGGTCCTTCAGCTGCCTCATATTTCTCGAGAAATATGAGGCAGCTGAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005197.3-1583s21c1
Sequence:CCGGGATCCGGTCCTGTTTGAATAACTCGAGTTATTCAAACAGGACCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005197.3-7086s21c1
Sequence:CCGGTCGATATGGTGAACCTATTAACTCGAGTTAATAGGTTCACCATATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183186
VALIDATED
FOXN3 MISSION shRNA Bacterial Glycerol Stock
forkhead box N3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000327479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183186.2-851s21c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-415s21c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-608s21c1
Sequence:CCGGAGTATTGGGAAAGGGTCATTGCTCGAGCAATGACCCTTTCCCAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183186.2-2300s21c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183186
VALIDATED
FOXN3 MISSION shRNA shRNA Plasmid DNA
forkhead box N3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000327479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183186.2-851s21c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-415s21c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-608s21c1
Sequence:CCGGAGTATTGGGAAAGGGTCATTGCTCGAGCAATGACCCTTTCCCAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183186.2-2300s21c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183186
VALIDATED
FOXN3 MISSION shRNA Lentiviral Transduction Particles
forkhead box N3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000327479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183186.2-851s21c1
Sequence:CCGGCCGTTACCAATCACTCCCATTCTCGAGAATGGGAGTGATTGGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-415s21c1
Sequence:CCGGCTCCTTTAGCTGCCTCATATTCTCGAGAATATGAGGCAGCTAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183186.2-608s21c1
Sequence:CCGGAGTATTGGGAAAGGGTCATTGCTCGAGCAATGACCCTTTCCCAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183186.2-2300s21c1
Sequence:CCGGGCACACAAACACACAACTTAACTCGAGTTAAGTTGTGTGTTTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)