EMAIL THIS PAGE TO A FRIEND

FRG1B

FSHD region gene 1 family, member B

99 Gene Product Result for
Synonyms: C20orf80 bA348I14.2
Species: Human FRG1B(284802)
UniProtKB ID: Q9BZ01, C4AME5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207350 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207350 Rosetta Predictions human pricing
NR_003579 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247001 predicted 296
2 SASI_Hs01_00247002 predicted 684
3 SASI_Hs01_00247003 predicted 399
4 SASI_Hs01_00247004 predicted 504
5 SASI_Hs01_00247005 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379630 predicted 852
2 SASI_Hs02_00379631 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207350
VALIDATED
FRG1B MISSION shRNA Bacterial Glycerol Stock
FSHD region gene 1 family, member B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-495s1c1
Sequence:CCGGCAGCTTGATACGTTGGAATCTCTCGAGAGATTCCAACGTATCAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-489s1c1
Sequence:CCGGGAAACCCAGCTTGATACGTTGCTCGAGCAACGTATCAAGCTGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-483s1c1
Sequence:CCGGGATGAAGAAACCCAGCTTGATCTCGAGATCAAGCTGGGTTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207350.1-558s1c1
Sequence:CCGGCCATTGAAATGGATGAGGGAACTCGAGTTCCCTCATCCATTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-480s1c1
Sequence:CCGGGAAGATGAAGAAACCCAGCTTCTCGAGAAGCTGGGTTTCTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-506s1c1
Sequence:CCGGGTTGGAATCTGGTGAACAGTACTCGAGTACTGTTCACCAGATTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207350
VALIDATED
FRG1B MISSION shRNA shRNA Plasmid DNA
FSHD region gene 1 family, member B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-495s1c1
Sequence:CCGGCAGCTTGATACGTTGGAATCTCTCGAGAGATTCCAACGTATCAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-489s1c1
Sequence:CCGGGAAACCCAGCTTGATACGTTGCTCGAGCAACGTATCAAGCTGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-483s1c1
Sequence:CCGGGATGAAGAAACCCAGCTTGATCTCGAGATCAAGCTGGGTTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207350.1-558s1c1
Sequence:CCGGCCATTGAAATGGATGAGGGAACTCGAGTTCCCTCATCCATTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-480s1c1
Sequence:CCGGGAAGATGAAGAAACCCAGCTTCTCGAGAAGCTGGGTTTCTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-506s1c1
Sequence:CCGGGTTGGAATCTGGTGAACAGTACTCGAGTACTGTTCACCAGATTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207350
VALIDATED
FRG1B MISSION shRNA Lentiviral Transduction Particles
FSHD region gene 1 family, member B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-495s1c1
Sequence:CCGGCAGCTTGATACGTTGGAATCTCTCGAGAGATTCCAACGTATCAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207350.1-489s1c1
Sequence:CCGGGAAACCCAGCTTGATACGTTGCTCGAGCAACGTATCAAGCTGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-483s1c1
Sequence:CCGGGATGAAGAAACCCAGCTTGATCTCGAGATCAAGCTGGGTTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207350.1-558s1c1
Sequence:CCGGCCATTGAAATGGATGAGGGAACTCGAGTTCCCTCATCCATTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-480s1c1
Sequence:CCGGGAAGATGAAGAAACCCAGCTTCTCGAGAAGCTGGGTTTCTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207350.1-506s1c1
Sequence:CCGGGTTGGAATCTGGTGAACAGTACTCGAGTACTGTTCACCAGATTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)