EMAIL THIS PAGE TO A FRIEND

FTCD

formimidoyltransferase cyclodeaminase

76 Gene Product Result for
Synonyms: LCHC1
Gene ID:
Human(10841) Summary: The protein encoded by this gene is a bifunctional enzyme that channels 1-carbon units from formiminoglutamate, a metabolite of the histidine degradation pathway, to the folate pool. Mutations in this gene are associated with glutamate formiminotransferase deficiency. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Dec 2009]
Mouse(14317) formiminotransferase cyclodeaminase
Rat(89833) formimidoyltransferase cyclodeaminase
Zebrafish(394052) formiminotransferase cyclodeaminase
chicken(395726) formiminotransferase cyclodeaminase
dog(607685) formiminotransferase cyclodeaminase
domestic cat(101080907) formiminotransferase cyclodeaminase
cow(535816) formiminotransferase cyclodeaminase
sheep(101106741) formiminotransferase cyclodeaminase
naked mole-rat(101712457) formimidoyltransferase cyclodeaminase
domestic guinea pig(100731799) formimidoyltransferase cyclodeaminase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500004 Anti-58K Golgi protein, N-Terminal/FTCD antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AV41576 Anti-FTCD antibody produced in rabbit IgG fraction of antiserum zebrafish, pig, rat, rabbit, human, guinea pig, canine, mouse, horse
immunohistochemistry, western blot pricing
HPA020073 Anti-FTCD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB2100859 Anti-FTCD antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, pig, rat, mouse, human, zebrafish
immunohistochemistry, western blot pricing
HPA030928 Anti-FTCD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA030929 Anti-FTCD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA036114 Anti-FTCD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
WH0010841M1 Monoclonal Anti-FTCD antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100479 Monoclonal Anti-FTCD antibody produced in mouse clone FTCD-A437, culture supernatant human
western blot pricing
SAB1404871 Monoclonal Anti-FTCD, (C-terminal) antibody produced in mouse clone 5F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
G2404 Monoclonal Anti-Golgi 58K Protein/Formiminotransferase Cyclodeaminase (FTCD) antibody produced in mouse clone 58K-9, ascites fluid monkey, hamster, mouse, bovine, pig, canine, human, rat, kangaroo rat
electron microscopy, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006657 Rosetta Predictions human pricing
NM_206965 Rosetta Predictions human pricing
NM_053567 Rosetta Predictions rat pricing
NM_080845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189538 predicted 746
2 SASI_Hs01_00189539 predicted 407
3 SASI_Hs02_00342038 predicted 746
4 SASI_Hs02_00342039 predicted 745
5 SASI_Hs01_00189540 predicted 760
6 SASI_Hs01_00189541 predicted 634
7 SASI_Hs01_00189544 predicted 238
8 SASI_Hs01_00189547 predicted 677
9 SASI_Hs02_00342040 predicted 222
10 SASI_Hs02_00342041 predicted 338
11 SASI_Hs01_00189542 predicted 705
12 SASI_Hs01_00189543 predicted 799
13 SASI_Hs01_00189545 predicted 263
14 SASI_Hs01_00189546 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051258 predicted 742
2 SASI_Hs01_00051259 predicted 400
3 SASI_Hs02_00373667 predicted 746
4 SASI_Hs02_00373668 predicted 745
5 SASI_Hs01_00051260 predicted 759
6 SASI_Hs01_00051262 predicted 637
7 SASI_Hs01_00051264 predicted 243
8 SASI_Hs01_00051267 predicted 676
9 SASI_Hs02_00373669 predicted 221
10 SASI_Hs02_00373670 predicted 344
11 SASI_Hs01_00051261 predicted 255
12 SASI_Hs01_00051263 predicted 800
13 SASI_Hs01_00051265 predicted 269
14 SASI_Hs01_00051266 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093303 predicted 1528
2 SASI_Rn01_00093304 predicted 1127
3 SASI_Rn01_00093305 predicted 571
4 SASI_Rn01_00093306 predicted 378
5 SASI_Rn01_00093307 predicted 549
6 SASI_Rn01_00093308 predicted 561
7 SASI_Rn01_00093309 predicted 970
8 SASI_Rn02_00266228 predicted 1486
9 SASI_Rn02_00266229 predicted 497
10 SASI_Rn01_00093310 predicted 617
11 SASI_Rn01_00093311 predicted 414
12 SASI_Rn01_00093312 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177101 predicted 1163
2 SASI_Mm01_00177102 predicted 415
3 SASI_Mm01_00177103 predicted 596
4 SASI_Mm01_00177104 predicted 1199
5 SASI_Mm01_00177105 predicted 762
6 SASI_Mm01_00177106 predicted 1524
7 SASI_Mm01_00177107 predicted 1010
8 SASI_Mm01_00177108 predicted 538
9 SASI_Mm01_00177109 predicted 907
10 SASI_Mm01_00177110 predicted 1676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006657
FTCD MISSION shRNA Bacterial Glycerol Stock
formimidoyltransferase cyclodeaminase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-1580s21c1
Sequence:CCGGCCAGATCCACCATCGTGTTTCCTCGAGGAAACACGATGGTGGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-602s21c1
Sequence:CCGGCATCAACCTGCTCGGCACAAACTCGAGTTTGTGCCGAGCAGGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-995s21c1
Sequence:CCGGTAAGGAGCGGATCATCGAGTACTCGAGTACTCGATGATCCGCTCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006657.2-1751s21c1
Sequence:CCGGAGTTCCACAGAGCACGGTACTCTCGAGAGTACCGTGCTCTGTGGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-1523s1c1
Sequence:CCGGCGCATATTTCAACGTGCTCATCTCGAGATGAGCACGTTGAAATATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-681s1c1
Sequence:CCGGCCAGGACGTCTGAAGAAAGTTCTCGAGAACTTTCTTCAGACGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-242s1c1
Sequence:CCGGCCGGGTAGCTTCCCGACTTATCTCGAGATAAGTCGGGAAGCTACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-747s1c1
Sequence:CCGGTCCACCAATCTTCTGGACTTTCTCGAGAAAGTCCAGAAGATTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-902s1c1
Sequence:CCGGCGAGAAGGAGAACCTCTTCATCTCGAGATGAAGAGGTTCTCCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006657
FTCD MISSION shRNA shRNA Plasmid DNA
formimidoyltransferase cyclodeaminase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-1580s21c1
Sequence:CCGGCCAGATCCACCATCGTGTTTCCTCGAGGAAACACGATGGTGGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-602s21c1
Sequence:CCGGCATCAACCTGCTCGGCACAAACTCGAGTTTGTGCCGAGCAGGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-995s21c1
Sequence:CCGGTAAGGAGCGGATCATCGAGTACTCGAGTACTCGATGATCCGCTCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006657.2-1751s21c1
Sequence:CCGGAGTTCCACAGAGCACGGTACTCTCGAGAGTACCGTGCTCTGTGGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-1523s1c1
Sequence:CCGGCGCATATTTCAACGTGCTCATCTCGAGATGAGCACGTTGAAATATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-681s1c1
Sequence:CCGGCCAGGACGTCTGAAGAAAGTTCTCGAGAACTTTCTTCAGACGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-242s1c1
Sequence:CCGGCCGGGTAGCTTCCCGACTTATCTCGAGATAAGTCGGGAAGCTACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-747s1c1
Sequence:CCGGTCCACCAATCTTCTGGACTTTCTCGAGAAAGTCCAGAAGATTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-902s1c1
Sequence:CCGGCGAGAAGGAGAACCTCTTCATCTCGAGATGAAGAGGTTCTCCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006657
FTCD MISSION shRNA Lentiviral Transduction Particles
formimidoyltransferase cyclodeaminase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-1580s21c1
Sequence:CCGGCCAGATCCACCATCGTGTTTCCTCGAGGAAACACGATGGTGGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-602s21c1
Sequence:CCGGCATCAACCTGCTCGGCACAAACTCGAGTTTGTGCCGAGCAGGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006657.2-995s21c1
Sequence:CCGGTAAGGAGCGGATCATCGAGTACTCGAGTACTCGATGATCCGCTCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006657.2-1751s21c1
Sequence:CCGGAGTTCCACAGAGCACGGTACTCTCGAGAGTACCGTGCTCTGTGGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-1523s1c1
Sequence:CCGGCGCATATTTCAACGTGCTCATCTCGAGATGAGCACGTTGAAATATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-681s1c1
Sequence:CCGGCCAGGACGTCTGAAGAAAGTTCTCGAGAACTTTCTTCAGACGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-242s1c1
Sequence:CCGGCCGGGTAGCTTCCCGACTTATCTCGAGATAAGTCGGGAAGCTACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-747s1c1
Sequence:CCGGTCCACCAATCTTCTGGACTTTCTCGAGAAAGTCCAGAAGATTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006657.2-902s1c1
Sequence:CCGGCGAGAAGGAGAACCTCTTCATCTCGAGATGAAGAGGTTCTCCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080845
FTCD MISSION shRNA Bacterial Glycerol Stock
formimidoyltransferase cyclodeaminase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080845.1-1676s1c1
Sequence:CCGGCCAGTATTCCTTACCTATCTTCTCGAGAAGATAGGTAAGGAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-236s1c1
Sequence:CCGGCATCGACATGAGCAAGCACAACTCGAGTTGTGCTTGCTCATGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-1524s1c1
Sequence:CCGGCTGAAGGACATGACGGATGATCTCGAGATCATCCGTCATGTCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-975s1c1
Sequence:CCGGGAACGGATCATCGAGTACCTACTCGAGTAGGTACTCGATGATCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-570s1c1
Sequence:CCGGGCATTCAATATCAACCTGCTACTCGAGTAGCAGGTTGATATTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080845
FTCD MISSION shRNA shRNA Plasmid DNA
formimidoyltransferase cyclodeaminase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080845.1-1676s1c1
Sequence:CCGGCCAGTATTCCTTACCTATCTTCTCGAGAAGATAGGTAAGGAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-236s1c1
Sequence:CCGGCATCGACATGAGCAAGCACAACTCGAGTTGTGCTTGCTCATGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-1524s1c1
Sequence:CCGGCTGAAGGACATGACGGATGATCTCGAGATCATCCGTCATGTCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-975s1c1
Sequence:CCGGGAACGGATCATCGAGTACCTACTCGAGTAGGTACTCGATGATCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-570s1c1
Sequence:CCGGGCATTCAATATCAACCTGCTACTCGAGTAGCAGGTTGATATTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080845
FTCD MISSION shRNA Lentiviral Transduction Particles
formimidoyltransferase cyclodeaminase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080845.1-1676s1c1
Sequence:CCGGCCAGTATTCCTTACCTATCTTCTCGAGAAGATAGGTAAGGAATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-236s1c1
Sequence:CCGGCATCGACATGAGCAAGCACAACTCGAGTTGTGCTTGCTCATGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-1524s1c1
Sequence:CCGGCTGAAGGACATGACGGATGATCTCGAGATCATCCGTCATGTCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-975s1c1
Sequence:CCGGGAACGGATCATCGAGTACCTACTCGAGTAGGTACTCGATGATCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080845.1-570s1c1
Sequence:CCGGGCATTCAATATCAACCTGCTACTCGAGTAGCAGGTTGATATTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)