EMAIL THIS PAGE TO A FRIEND

FTH1

ferritin, heavy polypeptide 1

86 Gene Product Result for
Synonyms: FHC FTH FTHL6 PIG15 PLIF
UniProtKB ID: P02794, B3KNR5, Q3KRA8, Q3SWW1
Gene ID:
Human(2495) Summary: This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14319) ferritin heavy chain 1
Rat(25319) ferritin, heavy polypeptide 1
Goat(100860752) ferritin, heavy polypeptide 1
sheep(443355) ferritin, heavy polypeptide 1
Domestic Rabbit(100009597) ferritin, heavy polypeptide 1
domestic guinea pig(100379547) ferritin heavy chain 1
naked mole-rat(101723628) ferritin, heavy polypeptide 1
chicken(395970) ferritin, heavy polypeptide 1
dog(100499480) ferritin, heavy polypeptide 1
cow(281173) ferritin, heavy polypeptide 1
Horse(100062811) ferritin, heavy polypeptide 1
domestic cat(654516) ferritin, heavy polypeptide 1
dog(403631) ferritin, heavy polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F5012 Anti-Ferritin, Human antibody produced in rabbit whole antiserum, liquid human
Ouchterlony double diffusion pricing
SAB2108662 Anti-FTH1 affinity isolated antibody horse, rabbit, bovine, guinea pig, horse, goat, mouse, rat, sheep, canine
immunohistochemistry, western blot pricing
F8306 Anti-FTH1 (151-165) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F8181 Anti-FTH1 (6-19) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW20077F Anti-FTH1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2500430 Anti-FTH1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405830 Anti-FTH1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1409042 Anti-FTH1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2100860 Anti-FTH1 antibody produced in rabbit affinity isolated antibody sheep, horse, canine, goat, human, rabbit, guinea pig, rat, rabbit, mouse, pig
western blot pricing
HPA043650 Anti-FTH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410457 Anti-FTH1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB4200598 Monoclonal Anti-FTH1 antibody produced in mouse ~1.0 mg/mL, clone FTH24, purified immunoglobulin human
flow cytometry, immunofluorescence, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0100 AQUA Peptide (pS)LLELH[K] African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002032 Rosetta Predictions human pricing
NM_012848 Rosetta Predictions rat pricing
NM_010239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112824 predicted 964
2 SASI_Hs01_00112825 predicted 991
3 SASI_Hs01_00112826 predicted 1008
4 SASI_Hs01_00112828 predicted 948
5 SASI_Hs01_00112829 predicted 957
6 SASI_Hs02_00333055 predicted 988
7 SASI_Hs02_00333056 predicted 734
8 SASI_Hs02_00333057 predicted 719
9 SASI_Hs02_00333058 predicted 522
10 SASI_Hs02_00333059 predicted 714
11 SASI_Hs01_00112827 predicted 960
12 SASI_Hs01_00112830 predicted 900
13 SASI_Hs01_00112831 predicted 591
14 SASI_Hs01_00112832 predicted 587
15 SASI_Hs01_00112833 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260320 predicted 343
2 SASI_Rn02_00260321 predicted 357
3 SASI_Rn02_00260322 predicted 456
4 SASI_Rn01_00079050 predicted 222
5 SASI_Rn01_00079052 predicted 570
6 SASI_Rn02_00260323 predicted 431
7 SASI_Rn01_00079053 predicted 513
8 SASI_Rn01_00079054 predicted 529
9 SASI_Rn02_00260324 predicted 276
10 SASI_Rn02_00260325 predicted 454
11 SASI_Rn01_00079051 predicted 556
12 SASI_Rn01_00079055 predicted 585
13 SASI_Rn01_00079056 predicted 587
14 SASI_Rn01_00079057 predicted 521
15 SASI_Rn01_00079058 predicted 205
16 SASI_Rn01_00079059 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318100 predicted 232
2 SASI_Mm01_00079394 predicted 401
3 SASI_Mm02_00318101 predicted 583
4 SASI_Mm02_00318102 predicted 494
5 SASI_Mm02_00318103 predicted 492
6 SASI_Mm01_00079396 predicted 219
7 SASI_Mm01_00079397 predicted 364
8 SASI_Mm01_00079399 predicted 307
9 SASI_Mm01_00079400 predicted 583
10 SASI_Mm02_00318104 predicted 617
11 SASI_Mm01_00079395 predicted 264
12 SASI_Mm01_00079398 predicted 238
13 SASI_Mm01_00079401 predicted 318
14 SASI_Mm01_00079402 predicted 328
15 SASI_Mm01_00079403 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002032
VALIDATED
FTH1 MISSION shRNA Bacterial Glycerol Stock
ferritin, heavy polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-643s1c1
Sequence:CCGGGCCTCGGGCTAATTTCCCATACTCGAGTATGGGAAATTAGCCCGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-327s1c1
Sequence:CCGGGCCGAATCTTCCTTCAGGATACTCGAGTATCCTGAAGGAAGATTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-196s1c1
Sequence:CCGGCCTGTCCATGTCTTACTACTTCTCGAGAAGTAGTAAGACATGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-249s1c1
Sequence:CCGGCCAAATACTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGTATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-233s1c1
Sequence:CCGGGCTTTGAAGAACTTTGCCAAACTCGAGTTTGGCAAAGTTCTTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-532s21c1
Sequence:CCGGTGCAATGGAGTGTGCATTACACTCGAGTGTAATGCACACTCCATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-319s21c1
Sequence:CCGGGCTCTACGCCTCCTACGTTTACTCGAGTAAACGTAGGAGGCGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-729s21c1
Sequence:CCGGGCTTGGCGGAATATCTCTTTGCTCGAGCAAAGAGATATTCCGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002032.2-1015s21c1
Sequence:CCGGGTGCCGTTGTTCAGTTCTAATCTCGAGATTAGAACTGAACAACGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002032
VALIDATED
FTH1 MISSION shRNA shRNA Plasmid DNA
ferritin, heavy polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-643s1c1
Sequence:CCGGGCCTCGGGCTAATTTCCCATACTCGAGTATGGGAAATTAGCCCGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-327s1c1
Sequence:CCGGGCCGAATCTTCCTTCAGGATACTCGAGTATCCTGAAGGAAGATTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-196s1c1
Sequence:CCGGCCTGTCCATGTCTTACTACTTCTCGAGAAGTAGTAAGACATGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-249s1c1
Sequence:CCGGCCAAATACTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGTATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-233s1c1
Sequence:CCGGGCTTTGAAGAACTTTGCCAAACTCGAGTTTGGCAAAGTTCTTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-532s21c1
Sequence:CCGGTGCAATGGAGTGTGCATTACACTCGAGTGTAATGCACACTCCATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-319s21c1
Sequence:CCGGGCTCTACGCCTCCTACGTTTACTCGAGTAAACGTAGGAGGCGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-729s21c1
Sequence:CCGGGCTTGGCGGAATATCTCTTTGCTCGAGCAAAGAGATATTCCGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002032.2-1015s21c1
Sequence:CCGGGTGCCGTTGTTCAGTTCTAATCTCGAGATTAGAACTGAACAACGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002032
VALIDATED
FTH1 MISSION shRNA Lentiviral Transduction Particles
ferritin, heavy polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-643s1c1
Sequence:CCGGGCCTCGGGCTAATTTCCCATACTCGAGTATGGGAAATTAGCCCGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-327s1c1
Sequence:CCGGGCCGAATCTTCCTTCAGGATACTCGAGTATCCTGAAGGAAGATTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-196s1c1
Sequence:CCGGCCTGTCCATGTCTTACTACTTCTCGAGAAGTAGTAAGACATGGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-249s1c1
Sequence:CCGGCCAAATACTTTCTTCACCAATCTCGAGATTGGTGAAGAAAGTATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002032.1-233s1c1
Sequence:CCGGGCTTTGAAGAACTTTGCCAAACTCGAGTTTGGCAAAGTTCTTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-532s21c1
Sequence:CCGGTGCAATGGAGTGTGCATTACACTCGAGTGTAATGCACACTCCATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-319s21c1
Sequence:CCGGGCTCTACGCCTCCTACGTTTACTCGAGTAAACGTAGGAGGCGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002032.2-729s21c1
Sequence:CCGGGCTTGGCGGAATATCTCTTTGCTCGAGCAAAGAGATATTCCGCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002032.2-1015s21c1
Sequence:CCGGGTGCCGTTGTTCAGTTCTAATCTCGAGATTAGAACTGAACAACGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010239
VALIDATED
FTH1 MISSION shRNA Bacterial Glycerol Stock
ferritin, heavy polypeptide 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-521s1c1
Sequence:CCGGGCACAAACTGGCTACTGACAACTCGAGTTGTCAGTAGCCAGTTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-405s1c1
Sequence:CCGGCGAATCTTCCTGCAGGATATACTCGAGTATATCCTGCAGGAAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-362s1c1
Sequence:CCGGGCATGCCGAGAAACTGATGAACTCGAGTTCATCAGTTTCTCGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-269s1c1
Sequence:CCGGCTATCTGTCTATGTCTTGTTACTCGAGTAACAAGACATAGACAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-570s1c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-561s1c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-588s1c1
Sequence:CCGGGAACAGGTGAAATCCATTAAACTCGAGTTTAATGGATTTCACCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-262s1c1
Sequence:CCGGCCTACGTCTATCTGTCTATGTCTCGAGACATAGACAGATAGACGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-623s1c1
Sequence:CCGGCGTGACCAACTTACGCAAGATCTCGAGATCTTGCGTAAGTTGGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-324s1c1
Sequence:CCGGGCCAAATACTTTCTCCACCAACTCGAGTTGGTGGAGAAAGTATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-237s1c1
Sequence:CCGGCAGATCAACCTGGAGTTGTATCTCGAGATACAACTCCAGGTTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-570s21c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-253s21c1
Sequence:CCGGTGTATGCCTCCTACGTCTATCCTCGAGGATAGACGTAGGAGGCATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-616s21c1
Sequence:CCGGGTGACCACGTGACCAACTTACCTCGAGGTAAGTTGGTCACGTGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-561s21c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010239
VALIDATED
FTH1 MISSION shRNA shRNA Plasmid DNA
ferritin, heavy polypeptide 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-521s1c1
Sequence:CCGGGCACAAACTGGCTACTGACAACTCGAGTTGTCAGTAGCCAGTTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-405s1c1
Sequence:CCGGCGAATCTTCCTGCAGGATATACTCGAGTATATCCTGCAGGAAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-362s1c1
Sequence:CCGGGCATGCCGAGAAACTGATGAACTCGAGTTCATCAGTTTCTCGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-269s1c1
Sequence:CCGGCTATCTGTCTATGTCTTGTTACTCGAGTAACAAGACATAGACAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-570s1c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-561s1c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-588s1c1
Sequence:CCGGGAACAGGTGAAATCCATTAAACTCGAGTTTAATGGATTTCACCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-262s1c1
Sequence:CCGGCCTACGTCTATCTGTCTATGTCTCGAGACATAGACAGATAGACGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-623s1c1
Sequence:CCGGCGTGACCAACTTACGCAAGATCTCGAGATCTTGCGTAAGTTGGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-324s1c1
Sequence:CCGGGCCAAATACTTTCTCCACCAACTCGAGTTGGTGGAGAAAGTATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-237s1c1
Sequence:CCGGCAGATCAACCTGGAGTTGTATCTCGAGATACAACTCCAGGTTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-570s21c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-253s21c1
Sequence:CCGGTGTATGCCTCCTACGTCTATCCTCGAGGATAGACGTAGGAGGCATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-616s21c1
Sequence:CCGGGTGACCACGTGACCAACTTACCTCGAGGTAAGTTGGTCACGTGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-561s21c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010239
VALIDATED
FTH1 MISSION shRNA Lentiviral Transduction Particles
ferritin, heavy polypeptide 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-521s1c1
Sequence:CCGGGCACAAACTGGCTACTGACAACTCGAGTTGTCAGTAGCCAGTTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-405s1c1
Sequence:CCGGCGAATCTTCCTGCAGGATATACTCGAGTATATCCTGCAGGAAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-362s1c1
Sequence:CCGGGCATGCCGAGAAACTGATGAACTCGAGTTCATCAGTTTCTCGGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-269s1c1
Sequence:CCGGCTATCTGTCTATGTCTTGTTACTCGAGTAACAAGACATAGACAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-570s1c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-561s1c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-588s1c1
Sequence:CCGGGAACAGGTGAAATCCATTAAACTCGAGTTTAATGGATTTCACCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010239.1-262s1c1
Sequence:CCGGCCTACGTCTATCTGTCTATGTCTCGAGACATAGACAGATAGACGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-623s1c1
Sequence:CCGGCGTGACCAACTTACGCAAGATCTCGAGATCTTGCGTAAGTTGGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010239.1-324s1c1
Sequence:CCGGGCCAAATACTTTCTCCACCAACTCGAGTTGGTGGAGAAAGTATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010239.1-237s1c1
Sequence:CCGGCAGATCAACCTGGAGTTGTATCTCGAGATACAACTCCAGGTTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-570s21c1
Sequence:CCGGGAGACGTATTATCTGAGTGAACTCGAGTTCACTCAGATAATACGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-253s21c1
Sequence:CCGGTGTATGCCTCCTACGTCTATCCTCGAGGATAGACGTAGGAGGCATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-616s21c1
Sequence:CCGGGTGACCACGTGACCAACTTACCTCGAGGTAAGTTGGTCACGTGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010239.1-561s21c1
Sequence:CCGGGACTTCATTGAGACGTATTATCTCGAGATAATACGTCTCAATGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)