EMAIL THIS PAGE TO A FRIEND

FTSJ1

FtsJ RNA methyltransferase homolog 1 (E. coli)

81 Gene Product Result for
Synonyms: CDLIV MRX44 MRX9 SPB1 TRMT7
UniProtKB ID: Q9UET6, B2RCJ0, O75670
Gene ID:
Human(24140) Summary: The protein encoded by this gene is a member of the S-adenosylmethionine-binding protein family. It is a nucleolar protein and may be involved in the processing and modification of rRNA. Three alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(54632) FtsJ homolog 1 (E. coli)
Rat(363450) FtsJ RNA methyltransferase homolog 1 (E. coli)
Zebrafish(492512) FtsJ homolog 1 (E. coli)
cow(517675) FtsJ RNA methyltransferase homolog 1 (E. coli)
domestic cat(101093418) FtsJ RNA methyltransferase homolog 1 (E. coli)
dog(480902) FtsJ RNA methyltransferase homolog 1 (E. coli)
sheep(101113204) FtsJ RNA methyltransferase homolog 1 (E. coli)
naked mole-rat(101700299) FtsJ RNA methyltransferase homolog 1 (E. coli)
domestic guinea pig(100729312) FtsJ RNA methyltransferase homolog 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002718 Anti-FTSJ1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV49131 Anti-FTSJ1 antibody produced in rabbit affinity isolated antibody rabbit, pig, canine, horse, mouse, human, rat, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012280 Rosetta Predictions human pricing
NM_177434 Rosetta Predictions human pricing
NM_177439 Rosetta Predictions human pricing
XM_001062916 Rosetta Predictions rat pricing
XM_343771 Rosetta Predictions rat pricing
NM_133991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155569 predicted 613
2 SASI_Hs01_00155570 predicted 1313
3 SASI_Hs01_00155571 predicted 1336
4 SASI_Hs01_00155572 predicted 1289
5 SASI_Hs02_00344012 predicted 1314
6 SASI_Hs01_00155574 predicted 1281
7 SASI_Hs01_00155575 predicted 729
8 SASI_Hs01_00155577 predicted 729
9 SASI_Hs02_00344013 predicted 1337
10 SASI_Hs02_00344014 predicted 723
11 SASI_Hs01_00155573 predicted 1321
12 SASI_Hs01_00155576 predicted 612
13 SASI_Hs01_00155578 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155479 predicted 348
2 SASI_Hs01_00155480 predicted 1033
3 SASI_Hs01_00155481 predicted 1057
4 SASI_Hs01_00155482 predicted 1012
5 SASI_Hs02_00369332 predicted 1039
6 SASI_Hs01_00155484 predicted 1007
7 SASI_Hs01_00155485 predicted 466
8 SASI_Hs01_00155487 predicted 459
9 SASI_Hs02_00369333 predicted 1068
10 SASI_Hs02_00369334 predicted 460
11 SASI_Hs01_00155483 predicted 1050
12 SASI_Hs01_00155486 predicted 345
13 SASI_Hs01_00155488 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243532 predicted 721
2 SASI_Hs01_00243533 predicted 1405
3 SASI_Hs01_00243534 predicted 1431
4 SASI_Hs01_00243535 predicted 1392
5 SASI_Hs02_00369337 predicted 1414
6 SASI_Hs01_00243537 predicted 1383
7 SASI_Hs01_00243538 predicted 841
8 SASI_Hs01_00243540 predicted 835
9 SASI_Hs02_00369338 predicted 1432
10 SASI_Hs02_00369339 predicted 834
11 SASI_Hs01_00243536 predicted 1424
12 SASI_Hs01_00243539 predicted 715
13 SASI_Hs01_00243541 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305069 predicted 873
2 SASI_Rn02_00305070 predicted 736
3 SASI_Rn02_00305071 predicted 959
4 SASI_Rn02_00305072 predicted 887
5 SASI_Rn02_00305073 predicted 706
6 SASI_Rn02_00305074 predicted 460
7 SASI_Rn02_00305075 predicted 268
8 SASI_Rn02_00305076 predicted 913
9 SASI_Rn02_00305077 predicted 496
10 SASI_Rn02_00305078 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396279 predicted 957
2 SASI_Rn02_00396280 predicted 943
3 SASI_Rn02_00396281 predicted 886
4 SASI_Rn02_00396282 predicted 944
5 SASI_Rn02_00396283 predicted 930
6 SASI_Rn02_00396284 predicted 926
7 SASI_Rn02_00396285 predicted 915
8 SASI_Rn02_00396286 predicted 928
9 SASI_Rn02_00396287 predicted 930
10 SASI_Rn02_00396288 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194759 predicted 1227
2 SASI_Mm01_00194760 predicted 1251
3 SASI_Mm01_00194761 predicted 1013
4 SASI_Mm01_00194762 predicted 1235
5 SASI_Mm01_00194763 predicted 686
6 SASI_Mm01_00194764 predicted 770
7 SASI_Mm01_00194765 predicted 698
8 SASI_Mm01_00194767 predicted 1102
9 SASI_Mm01_00194768 predicted 1219
10 SASI_Mm02_00339129 predicted 1311
11 SASI_Mm01_00194766 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133991
VALIDATED
FTSJ1 MISSION shRNA Bacterial Glycerol Stock
FtsJ RNA methyltransferase homolog 1 (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-380s1c1
Sequence:CCGGCCAACTCTTCAAAGGTGTGAACTCGAGTTCACACCTTTGAAGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133991.2-1216s1c1
Sequence:CCGGCCAAGGTGGAAGACAATGAAACTCGAGTTTCATTGTCTTCCACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-692s1c1
Sequence:CCGGCAACATCGCTACTCATGTCTTCTCGAGAAGACATGAGTAGCGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133991.2-2150s1c1
Sequence:CCGGGCCTGATAGTTGGATGTAGTACTCGAGTACTACATCCAACTATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133991.2-1217s21c1
Sequence:CCGGCAAGGTGGAAGACAATGAAATCTCGAGATTTCATTGTCTTCCACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-948s21c1
Sequence:CCGGGATGGTCCCACCCGTGTTATTCTCGAGAATAACACGGGTGGGACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-517s21c1
Sequence:CCGGTGCCAGGTGTGATACAGATACCTCGAGGTATCTGTATCACACCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-724s21c1
Sequence:CCGGGCTGCTTCGTGGCCAAGATATCTCGAGATATCTTGGCCACGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133991.2-1377s21c1
Sequence:CCGGGACCTAGAGTGAGAATCTATACTCGAGTATAGATTCTCACTCTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133991
VALIDATED
FTSJ1 MISSION shRNA shRNA Plasmid DNA
FtsJ RNA methyltransferase homolog 1 (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-380s1c1
Sequence:CCGGCCAACTCTTCAAAGGTGTGAACTCGAGTTCACACCTTTGAAGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133991.2-1216s1c1
Sequence:CCGGCCAAGGTGGAAGACAATGAAACTCGAGTTTCATTGTCTTCCACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-692s1c1
Sequence:CCGGCAACATCGCTACTCATGTCTTCTCGAGAAGACATGAGTAGCGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133991.2-2150s1c1
Sequence:CCGGGCCTGATAGTTGGATGTAGTACTCGAGTACTACATCCAACTATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133991.2-1217s21c1
Sequence:CCGGCAAGGTGGAAGACAATGAAATCTCGAGATTTCATTGTCTTCCACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-948s21c1
Sequence:CCGGGATGGTCCCACCCGTGTTATTCTCGAGAATAACACGGGTGGGACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-517s21c1
Sequence:CCGGTGCCAGGTGTGATACAGATACCTCGAGGTATCTGTATCACACCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-724s21c1
Sequence:CCGGGCTGCTTCGTGGCCAAGATATCTCGAGATATCTTGGCCACGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133991.2-1377s21c1
Sequence:CCGGGACCTAGAGTGAGAATCTATACTCGAGTATAGATTCTCACTCTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133991
VALIDATED
FTSJ1 MISSION shRNA Lentiviral Transduction Particles
FtsJ RNA methyltransferase homolog 1 (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-380s1c1
Sequence:CCGGCCAACTCTTCAAAGGTGTGAACTCGAGTTCACACCTTTGAAGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133991.2-1216s1c1
Sequence:CCGGCCAAGGTGGAAGACAATGAAACTCGAGTTTCATTGTCTTCCACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133991.2-692s1c1
Sequence:CCGGCAACATCGCTACTCATGTCTTCTCGAGAAGACATGAGTAGCGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133991.2-2150s1c1
Sequence:CCGGGCCTGATAGTTGGATGTAGTACTCGAGTACTACATCCAACTATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133991.2-1217s21c1
Sequence:CCGGCAAGGTGGAAGACAATGAAATCTCGAGATTTCATTGTCTTCCACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-948s21c1
Sequence:CCGGGATGGTCCCACCCGTGTTATTCTCGAGAATAACACGGGTGGGACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-517s21c1
Sequence:CCGGTGCCAGGTGTGATACAGATACCTCGAGGTATCTGTATCACACCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133991.2-724s21c1
Sequence:CCGGGCTGCTTCGTGGCCAAGATATCTCGAGATATCTTGGCCACGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133991.2-1377s21c1
Sequence:CCGGGACCTAGAGTGAGAATCTATACTCGAGTATAGATTCTCACTCTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012280
VALIDATED
FTSJ1 MISSION shRNA Bacterial Glycerol Stock
FtsJ RNA methyltransferase homolog 1 (E. coli)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-738s1c1
Sequence:CCGGGCTCTGAACATTGCTACACATCTCGAGATGTGTAGCAATGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-968s1c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-396s1c1
Sequence:CCGGAGCGCCTTCAAACTGCTACAACTCGAGTTGTAGCAGTTTGAAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-695s1c1
Sequence:CCGGCCATGATGTTGATGAGTATATCTCGAGATATACTCATCAACATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-1275s1c1
Sequence:CCGGCCTGAGATGGAAGACAATGAACTCGAGTTCATTGTCTTCCATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1300s21c1
Sequence:CCGGGTTGTTCACCTTAACCCATTACTCGAGTAATGGGTTAAGGTGAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012280.2-1678s21c1
Sequence:CCGGTAGCCTTACTCCCAAGTTATACTCGAGTATAACTTGGGAGTAAGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-968s21c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1053s21c1
Sequence:CCGGTATGATTCGGACCGCAGTTACCTCGAGGTAACTGCGGTCCGAATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012280
VALIDATED
FTSJ1 MISSION shRNA shRNA Plasmid DNA
FtsJ RNA methyltransferase homolog 1 (E. coli)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-738s1c1
Sequence:CCGGGCTCTGAACATTGCTACACATCTCGAGATGTGTAGCAATGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-968s1c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-396s1c1
Sequence:CCGGAGCGCCTTCAAACTGCTACAACTCGAGTTGTAGCAGTTTGAAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-695s1c1
Sequence:CCGGCCATGATGTTGATGAGTATATCTCGAGATATACTCATCAACATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-1275s1c1
Sequence:CCGGCCTGAGATGGAAGACAATGAACTCGAGTTCATTGTCTTCCATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1300s21c1
Sequence:CCGGGTTGTTCACCTTAACCCATTACTCGAGTAATGGGTTAAGGTGAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012280.2-1678s21c1
Sequence:CCGGTAGCCTTACTCCCAAGTTATACTCGAGTATAACTTGGGAGTAAGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-968s21c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1053s21c1
Sequence:CCGGTATGATTCGGACCGCAGTTACCTCGAGGTAACTGCGGTCCGAATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012280
VALIDATED
FTSJ1 MISSION shRNA Lentiviral Transduction Particles
FtsJ RNA methyltransferase homolog 1 (E. coli)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-738s1c1
Sequence:CCGGGCTCTGAACATTGCTACACATCTCGAGATGTGTAGCAATGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-968s1c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012280.2-396s1c1
Sequence:CCGGAGCGCCTTCAAACTGCTACAACTCGAGTTGTAGCAGTTTGAAGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-695s1c1
Sequence:CCGGCCATGATGTTGATGAGTATATCTCGAGATATACTCATCAACATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012280.2-1275s1c1
Sequence:CCGGCCTGAGATGGAAGACAATGAACTCGAGTTCATTGTCTTCCATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1300s21c1
Sequence:CCGGGTTGTTCACCTTAACCCATTACTCGAGTAATGGGTTAAGGTGAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012280.2-1678s21c1
Sequence:CCGGTAGCCTTACTCCCAAGTTATACTCGAGTATAACTTGGGAGTAAGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-968s21c1
Sequence:CCGGCCATTCTTACGACCCAGATTTCTCGAGAAATCTGGGTCGTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012280.2-1053s21c1
Sequence:CCGGTATGATTCGGACCGCAGTTACCTCGAGGTAACTGCGGTCCGAATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)