EMAIL THIS PAGE TO A FRIEND

FUCA2

fucosidase, alpha-L- 2, plasma

59 Gene Product Result for
Synonyms: dJ20N2.5
UniProtKB ID: Q9BTY2, Q7Z6Y2, Q8NBK4
Gene ID:
Human(2519) Summary: This gene encodes a plasma alpha-L-fucosidase, which represents 10-20% of the total cellular fucosidase activity. The protein is a member of the glycosyl hydrolase 29 family, and catalyzes the hydrolysis of the alpha-1,6-linked fucose joined to the reducing-end N-acetylglucosamine of the carbohydrate moieties of glycoproteins. This enzyme is essential for Helicobacter pylori adhesion to human gastric cancer cells. [provided by RefSeq, Aug 2010]
Mouse(66848) fucosidase, alpha-L- 2, plasma
Rat(292485) fucosidase, alpha-L- 2, plasma
Zebrafish(445487) fucosidase, alpha-L- 2, plasma
chicken(421668) fucosidase, alpha-L- 2, plasma
dog(484016) fucosidase, alpha-L- 2, plasma
cow(515729) fucosidase, alpha-L- 2, plasma
Horse(100067102) fucosidase, alpha-L- 2, plasma
domestic cat(101095340) fucosidase, alpha-L- 2, plasma
naked mole-rat(101723569) fucosidase, alpha-L- 2, plasma
domestic guinea pig(100733303) fucosidase, alpha-L- 2, plasma
sheep(101118364) fucosidase, alpha-L- 2, plasma
Domestic Rabbit(100349923) fucosidase, alpha-L- 2, plasma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100003 Anti-FUCA2 (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100002 Anti-FUCA2 (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300889 Anti-FUCA2 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1300888 Anti-FUCA2 (N-term) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405831 Anti-FUCA2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA031659 Anti-FUCA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry pricing
HPA031660 Anti-FUCA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry pricing
HPA031661 Anti-FUCA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human
immunohistochemistry pricing
SAB1402203 Monoclonal Anti-FUCA2, (C-terminal) antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032020 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088301 MISSION® esiRNA esiRNA human FUCA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032020 Rosetta Predictions human pricing
NM_001004218 Rosetta Predictions rat pricing
NM_025799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099057 predicted 1540
2 SASI_Hs01_00099058 predicted 690
3 SASI_Hs01_00099059 predicted 1520
4 SASI_Hs01_00099060 predicted 1476
5 SASI_Hs01_00099061 predicted 1015
6 SASI_Hs01_00099062 predicted 721
7 SASI_Hs01_00099064 predicted 1410
8 SASI_Hs01_00099065 predicted 1053
9 SASI_Hs01_00099066 predicted 920
10 SASI_Hs02_00359202 predicted 462
11 SASI_Hs01_00099063 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060238 predicted 1173
2 SASI_Rn02_00198208 predicted 915
3 SASI_Rn01_00060239 predicted 895
4 SASI_Rn01_00060240 predicted 582
5 SASI_Rn01_00060241 predicted 575
6 SASI_Rn01_00060242 predicted 1170
7 SASI_Rn02_00198209 predicted 213
8 SASI_Rn01_00060243 predicted 763
9 SASI_Rn01_00060244 predicted 1226
10 SASI_Rn01_00060246 predicted 1280
11 SASI_Rn01_00060245 predicted 1124
12 SASI_Rn01_00060247 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104524 predicted 273
2 SASI_Mm01_00104525 predicted 750
3 SASI_Mm01_00104526 predicted 926
4 SASI_Mm01_00104527 predicted 739
5 SASI_Mm01_00104528 predicted 639
6 SASI_Mm01_00104530 predicted 430
7 SASI_Mm02_00329047 predicted 958
8 SASI_Mm01_00104531 predicted 643
9 SASI_Mm01_00104532 predicted 1267
10 SASI_Mm01_00104533 predicted 1335
11 SASI_Mm01_00104529 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025799
VALIDATED
FUCA2 MISSION shRNA Bacterial Glycerol Stock
fucosidase, alpha-L- 2, plasma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1669s1c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1292s1c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025799.2-930s1c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-646s1c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-727s1c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-725s21c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025799.4-1667s21c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-928s21c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-1290s21c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-644s21c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025799
VALIDATED
FUCA2 MISSION shRNA shRNA Plasmid DNA
fucosidase, alpha-L- 2, plasma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1669s1c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1292s1c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025799.2-930s1c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-646s1c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-727s1c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-725s21c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025799.4-1667s21c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-928s21c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-1290s21c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-644s21c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025799
VALIDATED
FUCA2 MISSION shRNA Lentiviral Transduction Particles
fucosidase, alpha-L- 2, plasma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1669s1c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-1292s1c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025799.2-930s1c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-646s1c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025799.2-727s1c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-725s21c1
Sequence:CCGGGCAGCGATTTCCCGTTTCTAACTCGAGTTAGAAACGGGAAATCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025799.4-1667s21c1
Sequence:CCGGCCCTTCTTGTTCTTCCTAAATCTCGAGATTTAGGAAGAACAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-928s21c1
Sequence:CCGGGCAAACATGGTGGCTACTATACTCGAGTATAGTAGCCACCATGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-1290s21c1
Sequence:CCGGCCCGAGAAGAAATTAGTCTATCTCGAGATAGACTAATTTCTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025799.4-644s21c1
Sequence:CCGGCTTGCACTTTGGTCTGTACTACTCGAGTAGTACAGACCAAAGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032020
VALIDATED
FUCA2 MISSION shRNA Bacterial Glycerol Stock
fucosidase, alpha-L- 2, plasma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1422s1c1
Sequence:CCGGGAACTGCCACAGCTAACCATTCTCGAGAATGGTTAGCTGTGGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1014s1c1
Sequence:CCGGGCTGGAATCTCTGACTATCTTCTCGAGAAGATAGTCAGAGATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-927s1c1
Sequence:CCGGGATCGTTATAACCCAGGACATCTCGAGATGTCCTGGGTTATAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-728s1c1
Sequence:CCGGGCTCTATGAGTTAGTGAACAACTCGAGTTGTTCACTAACTCATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032020.3-1901s1c1
Sequence:CCGGGCCAACATCATAGAGTGTATTCTCGAGAATACACTCTATGATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1730s21c1
Sequence:CCGGGTGACTCAGAGGTGAGAATTTCTCGAGAAATTCTCACCTCTGAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-341s21c1
Sequence:CCGGACCGAAGTATGTGGAATTTATCTCGAGATAAATTCCACATACTTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1541s21c1
Sequence:CCGGGAACTATCAGGTGTCTATAATCTCGAGATTATAGACACCTGATAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-817s21c1
Sequence:CCGGGCTTCTTGGCCTGGTTATATACTCGAGTATATAACCAGGCCAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-366s21c1
Sequence:CCGGGATAATTACCCTCCTAGTTTCCTCGAGGAAACTAGGAGGGTAATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032020
VALIDATED
FUCA2 MISSION shRNA shRNA Plasmid DNA
fucosidase, alpha-L- 2, plasma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1422s1c1
Sequence:CCGGGAACTGCCACAGCTAACCATTCTCGAGAATGGTTAGCTGTGGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1014s1c1
Sequence:CCGGGCTGGAATCTCTGACTATCTTCTCGAGAAGATAGTCAGAGATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-927s1c1
Sequence:CCGGGATCGTTATAACCCAGGACATCTCGAGATGTCCTGGGTTATAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-728s1c1
Sequence:CCGGGCTCTATGAGTTAGTGAACAACTCGAGTTGTTCACTAACTCATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032020.3-1901s1c1
Sequence:CCGGGCCAACATCATAGAGTGTATTCTCGAGAATACACTCTATGATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1730s21c1
Sequence:CCGGGTGACTCAGAGGTGAGAATTTCTCGAGAAATTCTCACCTCTGAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-341s21c1
Sequence:CCGGACCGAAGTATGTGGAATTTATCTCGAGATAAATTCCACATACTTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1541s21c1
Sequence:CCGGGAACTATCAGGTGTCTATAATCTCGAGATTATAGACACCTGATAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-817s21c1
Sequence:CCGGGCTTCTTGGCCTGGTTATATACTCGAGTATATAACCAGGCCAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-366s21c1
Sequence:CCGGGATAATTACCCTCCTAGTTTCCTCGAGGAAACTAGGAGGGTAATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032020
VALIDATED
FUCA2 MISSION shRNA Lentiviral Transduction Particles
fucosidase, alpha-L- 2, plasma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1422s1c1
Sequence:CCGGGAACTGCCACAGCTAACCATTCTCGAGAATGGTTAGCTGTGGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-1014s1c1
Sequence:CCGGGCTGGAATCTCTGACTATCTTCTCGAGAAGATAGTCAGAGATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-927s1c1
Sequence:CCGGGATCGTTATAACCCAGGACATCTCGAGATGTCCTGGGTTATAACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032020.3-728s1c1
Sequence:CCGGGCTCTATGAGTTAGTGAACAACTCGAGTTGTTCACTAACTCATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159374    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032020.3-1901s1c1
Sequence:CCGGGCCAACATCATAGAGTGTATTCTCGAGAATACACTCTATGATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1730s21c1
Sequence:CCGGGTGACTCAGAGGTGAGAATTTCTCGAGAAATTCTCACCTCTGAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-341s21c1
Sequence:CCGGACCGAAGTATGTGGAATTTATCTCGAGATAAATTCCACATACTTCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032020.3-1541s21c1
Sequence:CCGGGAACTATCAGGTGTCTATAATCTCGAGATTATAGACACCTGATAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-817s21c1
Sequence:CCGGGCTTCTTGGCCTGGTTATATACTCGAGTATATAACCAGGCCAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032020.3-366s21c1
Sequence:CCGGGATAATTACCCTCCTAGTTTCCTCGAGGAAACTAGGAGGGTAATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)