EMAIL THIS PAGE TO A FRIEND

FUT11

fucosyltransferase 11 (alpha (1,3) fucosyltransferase)

113 Gene Product Result for
UniProtKB ID: Q495W5, Q495W7, Q8IYE4
Gene ID:
Mouse(73068) fucosyltransferase 11
Rat(286971) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Zebrafish(568888) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Thale Cress(821462) glycoprotein 3-alpha-L-fucosyltransferase A
cow(539329) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Horse(100064013) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
domestic cat(101097595) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
dog(609950) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
chicken(395071) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
sheep(101108628) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
domestic guinea pig(100720990) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
naked mole-rat(101711285) fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173540 Rosetta Predictions human pricing
NM_173308 Rosetta Predictions rat pricing
NM_028428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055693 predicted 1536
2 SASI_Hs01_00055694 predicted 485
3 SASI_Hs01_00055695 predicted 1375
4 SASI_Hs01_00055696 predicted 1564
5 SASI_Hs01_00055697 predicted 1522
6 SASI_Hs01_00055698 predicted 1058
7 SASI_Hs01_00055699 predicted 1119
8 SASI_Hs02_00368337 predicted 892
9 SASI_Hs01_00055700 predicted 1577
10 SASI_Hs01_00055701 predicted 1392
11 SASI_Hs01_00055692 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063723 predicted 1158
2 SASI_Rn01_00063724 predicted 978
3 SASI_Rn01_00063725 predicted 542
4 SASI_Rn02_00269400 predicted 868
5 SASI_Rn01_00063727 predicted 1089
6 SASI_Rn01_00063728 predicted 1154
7 SASI_Rn01_00063729 predicted 799
8 SASI_Rn01_00063730 predicted 284
9 SASI_Rn01_00063731 predicted 1252
10 SASI_Rn01_00063732 predicted 808
11 SASI_Rn01_00063726 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074154 predicted 1155
2 SASI_Mm01_00074155 predicted 979
3 SASI_Mm02_00333858 predicted 974
4 SASI_Mm01_00074156 predicted 1496
5 SASI_Mm01_00074157 predicted 1569
6 SASI_Mm01_00074158 predicted 1450
7 SASI_Mm01_00074160 predicted 1516
8 SASI_Mm01_00074161 predicted 1340
9 SASI_Mm01_00074162 predicted 1566
10 SASI_Mm01_00074163 predicted 470
11 SASI_Mm01_00074159 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173540
FUT11 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-847s21c1
Sequence:CCGGGGCTTTCTTGTCCCGCTATAACTCGAGTTATAGCGGGACAAGAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173540.2-1549s21c1
Sequence:CCGGGCGGAGCTAAGGAGATCTTATCTCGAGATAAGATCTCCTTAGCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-1387s21c1
Sequence:CCGGGATGTGGCTGCAAGATTATTGCTCGAGCAATAATCTTGCAGCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1039s1c1
Sequence:CCGGGCTGGCAGAGTTTATTGACTTCTCGAGAAGTCAATAAACTCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1003s1c1
Sequence:CCGGCGTCATCCTGATTGATGATTTCTCGAGAAATCATCAATCAGGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-535s1c1
Sequence:CCGGCTTCAATCTTACCTCCACCTTCTCGAGAAGGTGGAGGTAAGATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1435s1c1
Sequence:CCGGCACTGCCATGATCCACAACAACTCGAGTTGTTGTGGATCATGGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1486s1c1
Sequence:CCGGCCTACATGAAATCTTCATGAACTCGAGTTCATGAAGATTTCATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173540
FUT11 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-847s21c1
Sequence:CCGGGGCTTTCTTGTCCCGCTATAACTCGAGTTATAGCGGGACAAGAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173540.2-1549s21c1
Sequence:CCGGGCGGAGCTAAGGAGATCTTATCTCGAGATAAGATCTCCTTAGCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-1387s21c1
Sequence:CCGGGATGTGGCTGCAAGATTATTGCTCGAGCAATAATCTTGCAGCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1039s1c1
Sequence:CCGGGCTGGCAGAGTTTATTGACTTCTCGAGAAGTCAATAAACTCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1003s1c1
Sequence:CCGGCGTCATCCTGATTGATGATTTCTCGAGAAATCATCAATCAGGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-535s1c1
Sequence:CCGGCTTCAATCTTACCTCCACCTTCTCGAGAAGGTGGAGGTAAGATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1435s1c1
Sequence:CCGGCACTGCCATGATCCACAACAACTCGAGTTGTTGTGGATCATGGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1486s1c1
Sequence:CCGGCCTACATGAAATCTTCATGAACTCGAGTTCATGAAGATTTCATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173540
FUT11 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-847s21c1
Sequence:CCGGGGCTTTCTTGTCCCGCTATAACTCGAGTTATAGCGGGACAAGAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173540.2-1549s21c1
Sequence:CCGGGCGGAGCTAAGGAGATCTTATCTCGAGATAAGATCTCCTTAGCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173540.2-1387s21c1
Sequence:CCGGGATGTGGCTGCAAGATTATTGCTCGAGCAATAATCTTGCAGCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1039s1c1
Sequence:CCGGGCTGGCAGAGTTTATTGACTTCTCGAGAAGTCAATAAACTCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1003s1c1
Sequence:CCGGCGTCATCCTGATTGATGATTTCTCGAGAAATCATCAATCAGGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-535s1c1
Sequence:CCGGCTTCAATCTTACCTCCACCTTCTCGAGAAGGTGGAGGTAAGATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1435s1c1
Sequence:CCGGCACTGCCATGATCCACAACAACTCGAGTTGTTGTGGATCATGGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173540.1-1486s1c1
Sequence:CCGGCCTACATGAAATCTTCATGAACTCGAGTTCATGAAGATTTCATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028428
FUT11 MISSION shRNA Bacterial Glycerol Stock
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028428.1-1508s1c1
Sequence:CCGGGCCTTCATGTAAGAGCTGTTACTCGAGTAACAGCTCTTACATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1151s1c1
Sequence:CCGGCGATCCCATGTTGCCTAATTACTCGAGTAATTAGGCAACATGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-984s1c1
Sequence:CCGGGTCATCCTAATTGATGACTTTCTCGAGAAAGTCATCAATTAGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1294s1c1
Sequence:CCGGACATGAACTGTCCAGTGCCTACTCGAGTAGGCACTGGACAGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-837s1c1
Sequence:CCGGTCCCGGTATAAGTTCCACTTACTCGAGTAAGTGGAACTTATACCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028428
FUT11 MISSION shRNA shRNA Plasmid DNA
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028428.1-1508s1c1
Sequence:CCGGGCCTTCATGTAAGAGCTGTTACTCGAGTAACAGCTCTTACATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1151s1c1
Sequence:CCGGCGATCCCATGTTGCCTAATTACTCGAGTAATTAGGCAACATGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-984s1c1
Sequence:CCGGGTCATCCTAATTGATGACTTTCTCGAGAAAGTCATCAATTAGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1294s1c1
Sequence:CCGGACATGAACTGTCCAGTGCCTACTCGAGTAGGCACTGGACAGTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-837s1c1
Sequence:CCGGTCCCGGTATAAGTTCCACTTACTCGAGTAAGTGGAACTTATACCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028428
FUT11 MISSION shRNA Lentiviral Transduction Particles
fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028428.1-1508s1c1
Sequence:CCGGGCCTTCATGTAAGAGCTGTTACTCGAGTAACAGCTCTTACATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1151s1c1
Sequence:CCGGCGATCCCATGTTGCCTAATTACTCGAGTAATTAGGCAACATGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-984s1c1
Sequence:CCGGGTCATCCTAATTGATGACTTTCTCGAGAAAGTCATCAATTAGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-1294s1c1
Sequence:CCGGACATGAACTGTCCAGTGCCTACTCGAGTAGGCACTGGACAGTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028428.1-837s1c1
Sequence:CCGGTCCCGGTATAAGTTCCACTTACTCGAGTAAGTGGAACTTATACCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)