EMAIL THIS PAGE TO A FRIEND

GABARAPL2

GABA(A) receptor-associated protein-like 2

89 Gene Product Result for
Synonyms: ATG8 ATG8C GATE-16 GATE16 GEF-2 GEF2
UniProtKB ID: P60520, O08765, Q6FG91, Q9DCP8, Q9UQF7
Gene ID:
Mouse(93739) gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2
Rat(64670) GABA(A) receptor-associated protein like 2
sheep(101118469) GABA(A) receptor-associated protein-like 2
domestic guinea pig(100726484) GABA(A) receptor-associated protein-like 2
naked mole-rat(101706208) GABA(A) receptor-associated protein-like 2
Zebrafish(403036) GABA(A) receptor-associated protein-like 2
domestic cat(101097365) GABA(A) receptor-associated protein-like 2
cow(282531) GABA(A) receptor-associated protein-like 2
dog(479646) GABA(A) receptor-associated protein-like 2
chicken(770240) GABA(A) receptor-associated protein-like 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007285 Rosetta Predictions human pricing
NM_022706 Rosetta Predictions rat pricing
NM_026693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165606 predicted 304
2 SASI_Hs01_00165607 predicted 310
3 SASI_Hs01_00165608 predicted 412
4 SASI_Hs01_00165609 predicted 630
5 SASI_Hs01_00165611 predicted 505
6 SASI_Hs01_00165612 predicted 353
7 SASI_Hs01_00165614 predicted 405
8 SASI_Hs01_00165615 predicted 717
9 SASI_Hs02_00343356 predicted 392
10 SASI_Hs02_00343357 predicted 576
11 SASI_Hs01_00165610 predicted 772
12 SASI_Hs01_00165613 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263525 predicted 239
2 SASI_Rn02_00263526 predicted 240
3 SASI_Rn01_00084158 predicted 338
4 SASI_Rn02_00263527 predicted 296
5 SASI_Rn01_00084159 predicted 460
6 SASI_Rn01_00084160 predicted 322
7 SASI_Rn01_00084161 predicted 564
8 SASI_Rn01_00084162 predicted 358
9 SASI_Rn01_00084163 predicted 888
10 SASI_Rn02_00263528 predicted 918
11 SASI_Rn01_00084164 predicted 742
12 SASI_Rn01_00084165 predicted 882
13 SASI_Rn01_00084166 predicted 759
14 SASI_Rn01_00084167 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163085 predicted 215
2 SASI_Mm02_00330730 predicted 376
3 SASI_Mm02_00330731 predicted 357
4 SASI_Mm02_00330732 predicted 356
5 SASI_Mm02_00330733 predicted 367
6 SASI_Mm01_00163090 predicted 362
7 SASI_Mm02_00330734 predicted 369
8 SASI_Mm02_00330735 predicted 215
9 SASI_Mm02_00330736 predicted 228
10 SASI_Mm02_00330737 predicted 362
11 SASI_Mm01_00163086 predicted 786
12 SASI_Mm01_00163087 predicted 801
13 SASI_Mm01_00163088 predicted 923
14 SASI_Mm01_00163089 predicted 327
15 SASI_Mm01_00163091 predicted 838
16 SASI_Mm01_00163092 predicted 937
17 SASI_Mm01_00163093 predicted 840
18 SASI_Mm01_00163094 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026693
VALIDATED
GABARAPL2 MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-354s21c1
Sequence:CCGGCCACAGTCCAGCCTAACTATGCTCGAGCATAGTTAGGCTGGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-155s21c1
Sequence:CCGGCGCGAAGATCAGAGCGAAGTACTCGAGTACTTCGCTCTGATCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-274s21c1
Sequence:CCGGCTCAGTTCATGTGGATCATCACTCGAGTGATGATCCACATGAACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-400s21c1
Sequence:CCGGATGAAGATGGATTCTTGTATGCTCGAGCATACAAGAATCCATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-481s21c1
Sequence:CCGGTTCCTGCTTGTGTCTCTTGTACTCGAGTACAAGAGACACAAGCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-130s1c1
Sequence:CCGGTGGAACACAGATGCGTGGAATCTCGAGATTCCACGCATCTGTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-404s1c1
Sequence:CCGGTGGATTCTTGTATGTGGCCTACTCGAGTAGGCCACATACAAGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026693.2-823s1c1
Sequence:CCGGCCAGATTAAATCCTTAGCAATCTCGAGATTGCTAAGGATTTAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-227s1c1
Sequence:CCGGCATAGACAAGAGGAAGTACTTCTCGAGAAGTACTTCCTCTTGTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026693.2-361s1c1
Sequence:CCGGGCCTAACTATGGGACAGCTTTCTCGAGAAAGCTGTCCCATAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026693
VALIDATED
GABARAPL2 MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-354s21c1
Sequence:CCGGCCACAGTCCAGCCTAACTATGCTCGAGCATAGTTAGGCTGGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-155s21c1
Sequence:CCGGCGCGAAGATCAGAGCGAAGTACTCGAGTACTTCGCTCTGATCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-274s21c1
Sequence:CCGGCTCAGTTCATGTGGATCATCACTCGAGTGATGATCCACATGAACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-400s21c1
Sequence:CCGGATGAAGATGGATTCTTGTATGCTCGAGCATACAAGAATCCATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-481s21c1
Sequence:CCGGTTCCTGCTTGTGTCTCTTGTACTCGAGTACAAGAGACACAAGCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-130s1c1
Sequence:CCGGTGGAACACAGATGCGTGGAATCTCGAGATTCCACGCATCTGTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-404s1c1
Sequence:CCGGTGGATTCTTGTATGTGGCCTACTCGAGTAGGCCACATACAAGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026693.2-823s1c1
Sequence:CCGGCCAGATTAAATCCTTAGCAATCTCGAGATTGCTAAGGATTTAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-227s1c1
Sequence:CCGGCATAGACAAGAGGAAGTACTTCTCGAGAAGTACTTCCTCTTGTCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026693.2-361s1c1
Sequence:CCGGGCCTAACTATGGGACAGCTTTCTCGAGAAAGCTGTCCCATAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026693
VALIDATED
GABARAPL2 MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-354s21c1
Sequence:CCGGCCACAGTCCAGCCTAACTATGCTCGAGCATAGTTAGGCTGGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-155s21c1
Sequence:CCGGCGCGAAGATCAGAGCGAAGTACTCGAGTACTTCGCTCTGATCTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-274s21c1
Sequence:CCGGCTCAGTTCATGTGGATCATCACTCGAGTGATGATCCACATGAACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-400s21c1
Sequence:CCGGATGAAGATGGATTCTTGTATGCTCGAGCATACAAGAATCCATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026693.4-481s21c1
Sequence:CCGGTTCCTGCTTGTGTCTCTTGTACTCGAGTACAAGAGACACAAGCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-130s1c1
Sequence:CCGGTGGAACACAGATGCGTGGAATCTCGAGATTCCACGCATCTGTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-404s1c1
Sequence:CCGGTGGATTCTTGTATGTGGCCTACTCGAGTAGGCCACATACAAGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026693.2-823s1c1
Sequence:CCGGCCAGATTAAATCCTTAGCAATCTCGAGATTGCTAAGGATTTAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026693.2-227s1c1
Sequence:CCGGCATAGACAAGAGGAAGTACTTCTCGAGAAGTACTTCCTCTTGTCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026693.2-361s1c1
Sequence:CCGGGCCTAACTATGGGACAGCTTTCTCGAGAAAGCTGTCCCATAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007285
VALIDATED
GABARAPL2 MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-247s21c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-190s21c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-359s21c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-400s21c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-411s21c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-190s1c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-359s1c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-411s1c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-247s1c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-400s1c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007285
VALIDATED
GABARAPL2 MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-247s21c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-190s21c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-359s21c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-400s21c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-411s21c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-190s1c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-359s1c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-411s1c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-247s1c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-400s1c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007285
VALIDATED
GABARAPL2 MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-247s21c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-190s21c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-359s21c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-400s21c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007285.6-411s21c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-190s1c1
Sequence:CCGGCGCGAAGATTCGAGCGAAATACTCGAGTATTTCGCTCGAATCTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-359s1c1
Sequence:CCGGGCGATCTTCCTGTTTGTGGATCTCGAGATCCACAAACAGGAAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-411s1c1
Sequence:CCGGGACAGCTTTACGAGAAGGAAACTCGAGTTTCCTTCTCGTAAAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-247s1c1
Sequence:CCGGAGGCTCTCAGATTGTTGACATCTCGAGATGTCAACAATCTGAGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007285.6-400s1c1
Sequence:CCGGCCTAACTATGGGACAGCTTTACTCGAGTAAAGCTGTCCCATAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)