EMAIL THIS PAGE TO A FRIEND

GABRA1

gamma-aminobutyric acid (GABA) A receptor, alpha 1

378 Gene Product Result for
Synonyms: ECA4 EJM EJM5
UniProtKB ID: P14867, D3DQK6, Q8N629
Gene ID:
Human(2554) Summary: This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14394) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
Rat(29705) gamma-aminobutyric acid (GABA) A receptor, alpha 1
Zebrafish(768183) gamma-aminobutyric acid (GABA) A receptor, alpha 1
dog(489143) gamma-aminobutyric acid (GABA) A receptor, alpha 1
domestic cat(100286792) gamma-aminobutyric acid (GABA) A receptor, alpha 1
chicken(374214) gamma-aminobutyric acid (GABA) A receptor, alpha 1
cow(780973) gamma-aminobutyric acid (GABA) A receptor, alpha 1
sheep(101117759) gamma-aminobutyric acid (GABA) A receptor, alpha 1
naked mole-rat(101719179) gamma-aminobutyric acid (GABA) A receptor, alpha 1
domestic guinea pig(100721626) gamma-aminobutyric acid (GABA) A receptor, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB5609 Anti-GABA A Receptor α1 Antibody, cytoplasmic loop clone, Chemicon®, from rabbit rat
immunoprecipitation (IP), western blot pricing
MAB339 Anti-GABA A Receptor α1 chain Antibody, NT, clone BD24 clone BD24, Chemicon®, from mouse pig, human, bovine, avian
immunohistochemistry, immunoprecipitation (IP), western blot pricing
05-474 Anti-GABA A Receptor β2/3 Antibody clone 62-3G1, Upstate®, from mouse human, rat, bovine
immunohistochemistry, immunoprecipitation (IP), western blot pricing
G4416 Anti-GABAA Receptor (α1 subunit) antibody produced in rabbit affinity isolated antibody rat, bovine (predicted), mouse, chicken (predicted), human (predicted)
immunohistochemistry, western blot pricing
SAB2701859 Anti-gabra1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA055746 Anti-GABRA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
western blot pricing
SAB2100876 Anti-GABRA1 antibody produced in rabbit affinity isolated antibody horse, guinea pig, dog, mouse, bovine, human, rat, rabbit
western blot pricing
AV34976 Anti-GABRA1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, human
western blot pricing
FCMAB408PE Milli-Mark Anti-GABA A Receptor β2/3-PE Antibody, clone 62-3G1 clone 62-3G1, Milli-Mark®, from mouse rat, rat
flow cytometry pricing
SAB5200053 Monoclonal Anti-GABRA1 antibody produced in mouse clone S96-55, 1 mg/mL, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1724350 Zaleplon United States Pharmacopeia (USP) Reference Standard human pricing
Z0502 Zaleplon ≥98% (HPLC), solid human pricing
Z-004 Zaleplon solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0002139 Zolpidem for system suitability CRS, European Pharmacopoeia (EP) Reference Standard human pricing
Z-017 Zolpidem solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
137731 2,4-Di-tert-butylphenol 99% human pricing
D48400 2,6-Di-tert-butylphenol 99% human pricing
478601 2,6-Diethylphenyl isocyanate 98% human pricing
376930 2,6-Diisopropylphenyl isocyanate 97% human pricing
308218 2,6-Diisopropylphenyl isocyanate technical grade, 90% human pricing
D135550 2,6-Dimethoxyphenol 99% human pricing
W313726 2,6-Dimethoxyphenol natural, ≥96% human pricing
306940 2,6-Dimethylbenzenethiol 95% human pricing
W366609 2,6-Dimethylbenzenethiol ≥95%, FG human pricing
246867 2-Cyclopentylphenol technical grade, 95% human pricing
343668 2-Hydroxy-3-isopropylbenzoic acid 98% human pricing
I27503 2-Isopropylbenzenethiol technical grade, 90% human pricing
B97607 2-tert-Butyl-6-methyl-phenol 99% human pricing
D125601 3,5-Diisopropylcatechol technical grade, 90% human pricing
P9346 Liquified Phenol ≥89.0% human pricing
P1037 Phenol for molecular biology human pricing
33517 Phenol puriss. p.a., ACS reagent, reag. Ph. Eur., 99.0-100.5% human pricing
P5566 Phenol BioXtra, ≥99.5% (GC) human pricing
242322 Phenol contains hypophosphorous as stabilizer, loose crystals, ACS reagent, ≥99.0% human pricing
W322318 Phenol ≥99% human pricing
185450 Phenol unstabilized, ReagentPlus®, ≥99% human pricing
328111 Phenol unstabilized, purified by redistillation, ≥99% human pricing
16018 Phenol ≥96.0% (calc. on dry substance, T) human pricing
77607 Phenol BioUltra, for molecular biology, TE-saturated, ~73% (T) human pricing
16017 Phenol puriss., meets analytical specification of Ph. Eur., BP, USP, 99.5-100.5% (GC) human pricing
P4557 Phenol solution BioReagent, Equilibrated with 10 mM Tris HCl, pH 8.0, 1 mM EDTA, for molecular biology human pricing
P4682 Phenol solution BioReagent, Saturated with 0.1 M citrate buffer, pH 4.3 ± 0.2, for molecular biology human pricing
48688 Phenol solution certified reference material, 500 μg/mL in methanol human pricing
40063 Phenol solution 5000 μg/mL in methanol, certified reference material human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
E5126 Etiocholan-3α-ol-17-one human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000806 Rosetta Predictions human pricing
NM_001127643 Rosetta Predictions human pricing
NM_001127644 Rosetta Predictions human pricing
NM_001127645 Rosetta Predictions human pricing
NM_001127646 Rosetta Predictions human pricing
NM_001127647 Rosetta Predictions human pricing
NM_001127648 Rosetta Predictions human pricing
NM_183326 Rosetta Predictions rat pricing
NM_010250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105556 predicted 1465
2 SASI_Hs01_00105557 predicted 1257
3 SASI_Hs01_00105558 predicted 1151
4 SASI_Hs02_00303265 predicted 956
5 SASI_Hs01_00105559 predicted 1019
6 SASI_Hs01_00105560 predicted 1448
7 SASI_Hs01_00105562 predicted 1897
8 SASI_Hs01_00105563 predicted 1486
9 SASI_Hs01_00105564 predicted 707
10 SASI_Hs02_00303266 predicted 1654
11 SASI_Hs01_00105555 predicted 465
12 SASI_Hs01_00105561 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329924 predicted 1359
2 SASI_Hs02_00329925 predicted 1136
3 SASI_Hs02_00329926 predicted 1038
4 SASI_Hs02_00329927 predicted 841
5 SASI_Hs02_00329928 predicted 900
6 SASI_Hs02_00329929 predicted 1337
7 SASI_Hs02_00329930 predicted 1780
8 SASI_Hs02_00329931 predicted 1369
9 SASI_Hs02_00329932 predicted 600
10 SASI_Hs02_00329933 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329934 predicted 1500
2 SASI_Hs02_00329935 predicted 1293
3 SASI_Hs02_00329936 predicted 1194
4 SASI_Hs02_00329937 predicted 988
5 SASI_Hs02_00329938 predicted 1053
6 SASI_Hs02_00329939 predicted 1481
7 SASI_Hs02_00329940 predicted 1928
8 SASI_Hs02_00329941 predicted 1522
9 SASI_Hs02_00329942 predicted 745
10 SASI_Hs02_00329943 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329944 predicted 1096
2 SASI_Hs02_00329945 predicted 879
3 SASI_Hs02_00329946 predicted 774
4 SASI_Hs02_00329947 predicted 580
5 SASI_Hs02_00329948 predicted 636
6 SASI_Hs02_00329949 predicted 1070
7 SASI_Hs02_00329950 predicted 1515
8 SASI_Hs02_00329951 predicted 1104
9 SASI_Hs02_00329952 predicted 332
10 SASI_Hs02_00329953 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329954 predicted 1156
2 SASI_Hs02_00329955 predicted 943
3 SASI_Hs02_00329956 predicted 844
4 SASI_Hs02_00329957 predicted 645
5 SASI_Hs02_00329958 predicted 711
6 SASI_Hs02_00329959 predicted 1134
7 SASI_Hs02_00329960 predicted 1585
8 SASI_Hs02_00329961 predicted 1174
9 SASI_Hs02_00329962 predicted 397
10 SASI_Hs02_00329963 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329964 predicted 1312
2 SASI_Hs02_00329965 predicted 1098
3 SASI_Hs02_00329966 predicted 1005
4 SASI_Hs02_00329967 predicted 804
5 SASI_Hs02_00329968 predicted 864
6 SASI_Hs02_00329969 predicted 1289
7 SASI_Hs02_00329970 predicted 1747
8 SASI_Hs02_00329971 predicted 1328
9 SASI_Hs02_00329972 predicted 554
10 SASI_Hs02_00329973 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329974 predicted 1109
2 SASI_Hs02_00329975 predicted 901
3 SASI_Hs02_00329976 predicted 798
4 SASI_Hs02_00329977 predicted 596
5 SASI_Hs02_00329978 predicted 661
6 SASI_Hs02_00329979 predicted 1097
7 SASI_Hs02_00329980 predicted 1543
8 SASI_Hs02_00329981 predicted 1130
9 SASI_Hs02_00329982 predicted 358
10 SASI_Hs02_00329983 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085820 predicted 1410
2 SASI_Rn01_00085821 predicted 1403
3 SASI_Rn01_00085822 predicted 886
4 SASI_Rn01_00085823 predicted 972
5 SASI_Rn01_00085824 predicted 1661
6 SASI_Rn01_00085826 predicted 624
7 SASI_Rn01_00085827 predicted 1016
8 SASI_Rn01_00085828 predicted 1395
9 SASI_Rn01_00085829 predicted 1670
10 SASI_Rn02_00269876 predicted 1399
11 SASI_Rn01_00085825 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035665 predicted 1558
2 SASI_Mm01_00035667 predicted 1567
3 SASI_Mm01_00035668 predicted 1559
4 SASI_Mm01_00035670 predicted 1643
5 SASI_Mm01_00035671 predicted 1950
6 SASI_Mm02_00318139 predicted 1950
7 SASI_Mm01_00035672 predicted 1720
8 SASI_Mm01_00035673 predicted 1052
9 SASI_Mm01_00035674 predicted 2185
10 SASI_Mm02_00318140 predicted 882
11 SASI_Mm01_00035666 predicted 933
12 SASI_Mm01_00035669 predicted 1532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000806
GABRA1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-645s21c1
Sequence:CCGGAGGATTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1179s21c1
Sequence:CCGGTGTTGTTATGACCACTCATTTCTCGAGAAATGAGTGGTCATAACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1536s21c1
Sequence:CCGGAGTAAAGGATCCTCTTATTAACTCGAGTTAATAAGAGGATCCTTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-400s1c1
Sequence:CCGGCCGTCATTACAAGATGAACTTCTCGAGAAGTTCATCTTGTAATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1575s1c1
Sequence:CCGGCCGACTGTCAAGAATAGCCTTCTCGAGAAGGCTATTCTTGACAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-645s1c1
Sequence:CCGGCCTCCGGTTAAATAACCTAATCTCGAGATTAGGTTATTTAACCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1596s1c1
Sequence:CCGGCCCGCTGCTATTTGGAATCTTCTCGAGAAGATTCCAAATAGCAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1777s21c1
Sequence:CCGGGTCTACTGGGCTACGTATTTACTCGAGTAAATACGTAGCCCAGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000806
GABRA1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-645s21c1
Sequence:CCGGAGGATTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1179s21c1
Sequence:CCGGTGTTGTTATGACCACTCATTTCTCGAGAAATGAGTGGTCATAACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1536s21c1
Sequence:CCGGAGTAAAGGATCCTCTTATTAACTCGAGTTAATAAGAGGATCCTTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-400s1c1
Sequence:CCGGCCGTCATTACAAGATGAACTTCTCGAGAAGTTCATCTTGTAATGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1575s1c1
Sequence:CCGGCCGACTGTCAAGAATAGCCTTCTCGAGAAGGCTATTCTTGACAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-645s1c1
Sequence:CCGGCCTCCGGTTAAATAACCTAATCTCGAGATTAGGTTATTTAACCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1596s1c1
Sequence:CCGGCCCGCTGCTATTTGGAATCTTCTCGAGAAGATTCCAAATAGCAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1777s21c1
Sequence:CCGGGTCTACTGGGCTACGTATTTACTCGAGTAAATACGTAGCCCAGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000806
GABRA1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-645s21c1
Sequence:CCGGAGGATTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAATCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1179s21c1
Sequence:CCGGTGTTGTTATGACCACTCATTTCTCGAGAAATGAGTGGTCATAACAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1536s21c1
Sequence:CCGGAGTAAAGGATCCTCTTATTAACTCGAGTTAATAAGAGGATCCTTTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-400s1c1
Sequence:CCGGCCGTCATTACAAGATGAACTTCTCGAGAAGTTCATCTTGTAATGACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1575s1c1
Sequence:CCGGCCGACTGTCAAGAATAGCCTTCTCGAGAAGGCTATTCTTGACAGTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-645s1c1
Sequence:CCGGCCTCCGGTTAAATAACCTAATCTCGAGATTAGGTTATTTAACCGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000806.3-1596s1c1
Sequence:CCGGCCCGCTGCTATTTGGAATCTTCTCGAGAAGATTCCAAATAGCAGCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000806.5-1777s21c1
Sequence:CCGGGTCTACTGGGCTACGTATTTACTCGAGTAAATACGTAGCCCAGTAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010250
GABRA1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000424202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-954s21c1
Sequence:CCGGAGGTTTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010250.x-1387s1c1
Sequence:CCGGCCGTTCAGTGGTTGTAGCAGACTCGAGTCTGCTACAACCACTGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-2086s21c1
Sequence:CCGGGTCTATTGGGCCACGTATTTACTCGAGTAAATACGTGGCCCAATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010250
GABRA1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000424202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-954s21c1
Sequence:CCGGAGGTTTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010250.x-1387s1c1
Sequence:CCGGCCGTTCAGTGGTTGTAGCAGACTCGAGTCTGCTACAACCACTGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-2086s21c1
Sequence:CCGGGTCTATTGGGCCACGTATTTACTCGAGTAAATACGTGGCCCAATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010250
GABRA1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000424202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-954s21c1
Sequence:CCGGAGGTTTGGGAGAGCGTGTAACCTCGAGGTTACACGCTCTCCCAAACCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010250.x-1387s1c1
Sequence:CCGGCCGTTCAGTGGTTGTAGCAGACTCGAGTCTGCTACAACCACTGAACGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010250.4-2086s21c1
Sequence:CCGGGTCTATTGGGCCACGTATTTACTCGAGTAAATACGTGGCCCAATAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???