EMAIL THIS PAGE TO A FRIEND

GABRA2

gamma-aminobutyric acid (GABA) A receptor, alpha 2

254 Gene Product Result for
UniProtKB ID: P47869, Q59G14
Gene ID:
Human(2555) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14395) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
Rat(289606) gamma-aminobutyric acid (GABA) A receptor, alpha 2
domestic guinea pig(100720796) gamma-aminobutyric acid (GABA) A receptor, alpha 2
naked mole-rat(101720776) gamma-aminobutyric acid (GABA) A receptor, alpha 2
sheep(101121265) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Domestic Rabbit(100339376) gamma-aminobutyric acid (GABA) A receptor, alpha 2
chicken(770511) gamma-aminobutyric acid (GABA) A receptor, alpha 2
domestic cat(100286789) gamma-aminobutyric acid (GABA) A receptor, alpha 2
cow(282236) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Horse(100061914) gamma-aminobutyric acid (GABA) A receptor, alpha 2
dog(482131) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV13026 Anti-GABRA2 antibody produced in rabbit IgG fraction of antiserum horse, bovine, rat, dog, mouse, rabbit, human
western blot pricing
HPA014261 Anti-GABRA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5202094 Monoclonal Anti-GABA A Receptor antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202103 Monoclonal Anti-GABA A Receptor-Alkaline Phosphatase antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202104 Monoclonal Anti-GABA A Receptor-Allophycocyanin antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202095 Monoclonal Anti-GABA A Receptor-Atto 390 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202096 Monoclonal Anti-GABA A Receptor-Atto 488 antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202098 Monoclonal Anti-GABA A Receptor-Atto 594 antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202097 Monoclonal Anti-GABA A Receptor-Atto 595 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202099 Monoclonal Anti-GABA A Receptor-Atto 633 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202100 Monoclonal Anti-GABA A Receptor-Atto 655 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202101 Monoclonal Anti-GABA A Receptor-Atto 680 antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202102 Monoclonal Anti-GABA A Receptor-Atto 700 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202105 Monoclonal Anti-GABA A Receptor-Biotin antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202106 Monoclonal Anti-GABA A Receptor-FITC antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202107 Monoclonal Anti-GABA A Receptor-Horseradish Peroxidase antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202108 Monoclonal Anti-GABA A Receptor-PE/Atto 594 antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202109 Monoclonal Anti-GABA A Receptor-PerCP antibody produced in mouse clone S399-19 rat, human
immunofluorescence, western blot pricing
SAB5202110 Monoclonal Anti-GABA A Receptor-R-Phycoerythrin antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing
SAB5202111 Monoclonal Anti-GABA A Receptor-Streptavidin antibody produced in mouse clone S399-19 human, rat
immunofluorescence, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B4144 Bromazepam analytical standard human pricing
B1143000 Bromazepam European Pharmacopoeia (EP) Reference Standard human pricing
1076465 Bromazepam United States Pharmacopeia (USP) Reference Standard human pricing
B-903 Bromazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000807 Rosetta Predictions human pricing
NM_001114175 Rosetta Predictions human pricing
XM_223378 Rosetta Predictions rat pricing
XR_009140 Rosetta Predictions rat pricing
NM_008066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303267 predicted 553
2 SASI_Hs01_00058931 predicted 1756
3 SASI_Hs01_00058932 predicted 906
4 SASI_Hs02_00303268 predicted 896
5 SASI_Hs01_00058933 predicted 629
6 SASI_Hs02_00303269 predicted 1251
7 SASI_Hs02_00303270 predicted 1114
8 SASI_Hs01_00058934 predicted 1142
9 SASI_Hs01_00058936 predicted 884
10 SASI_Hs01_00058938 predicted 1198
11 SASI_Hs01_00058935 predicted 1079
12 SASI_Hs01_00058937 predicted 397
13 SASI_Hs01_00058939 predicted 708
14 SASI_Hs01_00058940 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326434 predicted 906
2 SASI_Hs02_00326435 predicted 2115
3 SASI_Hs02_00326436 predicted 1265
4 SASI_Hs02_00326437 predicted 1251
5 SASI_Hs02_00326438 predicted 985
6 SASI_Hs02_00326439 predicted 1615
7 SASI_Hs02_00326440 predicted 1471
8 SASI_Hs02_00326441 predicted 1500
9 SASI_Hs02_00326442 predicted 1240
10 SASI_Hs02_00326443 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381305 predicted 1817
2 SASI_Rn02_00381306 predicted 1138
3 SASI_Rn02_00381307 predicted 1070
4 SASI_Rn02_00381308 predicted 1803
5 SASI_Rn02_00381309 predicted 1764
6 SASI_Rn02_00381310 predicted 1796
7 SASI_Rn02_00381311 predicted 1710
8 SASI_Rn02_00381312 predicted 1082
9 SASI_Rn02_00381313 predicted 1070
10 SASI_Rn02_00381314 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00418873 predicted 846
2 SASI_Rn02_00418874 predicted 693
3 SASI_Rn02_00418875 predicted 492
4 SASI_Rn02_00418876 predicted 447
5 SASI_Rn02_00418877 predicted 362
6 SASI_Rn02_00418878 predicted 515
7 SASI_Rn02_00418879 predicted 284
8 SASI_Rn02_00418880 predicted 1015
9 SASI_Rn02_00418881 predicted 978
10 SASI_Rn02_00418882 predicted 713
11 SASI_Rn01_00136979 predicted 1822
12 SASI_Rn01_00136980 predicted 1137
13 SASI_Rn01_00136981 predicted 1077
14 SASI_Rn01_00136982 predicted 1809
15 SASI_Rn01_00136983 predicted 1767
16 SASI_Rn01_00136984 predicted 1803
17 SASI_Rn01_00136985 predicted 1183
18 SASI_Rn01_00136986 predicted 1715
19 SASI_Rn01_00136987 predicted 1083
20 SASI_Rn01_00136988 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071373 predicted 523
2 SASI_Mm01_00071374 predicted 944
3 SASI_Mm01_00071375 predicted 1231
4 SASI_Mm01_00071376 predicted 1350
5 SASI_Mm01_00071377 predicted 737
6 SASI_Mm01_00071378 predicted 957
7 SASI_Mm01_00071379 predicted 1669
8 SASI_Mm02_00313052 predicted 1723
9 SASI_Mm01_00071380 predicted 762
10 SASI_Mm01_00071381 predicted 692
11 SASI_Mm01_00071382 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000807
GABRA2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000807
GABRA2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000807
GABRA2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008066
GABRA2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008066
GABRA2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008066
GABRA2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)