EMAIL THIS PAGE TO A FRIEND

GABRA3

gamma-aminobutyric acid (GABA) A receptor, alpha 3

175 Gene Product Result for
UniProtKB ID: P34903, Q8TAF9
Gene ID:
Human(2556) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
Mouse(14396) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 3
Rat(24947) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Zebrafish(100884145) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Zebrafish(100333913) gamma-aminobutyric acid (GABA) A receptor, alpha 3
cow(282237) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Horse(100063420) gamma-aminobutyric acid (GABA) A receptor, alpha 3
domestic cat(100294524) gamma-aminobutyric acid (GABA) A receptor, alpha 3
dog(492223) gamma-aminobutyric acid (GABA) A receptor, alpha 3
chicken(422289) gamma-aminobutyric acid (GABA) A receptor, alpha 3
sheep(101113565) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Domestic Rabbit(100349107) gamma-aminobutyric acid (GABA) A receptor, alpha 3
naked mole-rat(101714519) gamma-aminobutyric acid (GABA) A receptor, alpha 3
domestic guinea pig(100725783) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038321 MISSION® esiRNA targeting human GABRA3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000808 Rosetta Predictions human pricing
NM_017069 Rosetta Predictions rat pricing
NM_008067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303271 predicted 1695
2 SASI_Hs01_00195413 predicted 401
3 SASI_Hs01_00195414 predicted 847
4 SASI_Hs01_00195415 predicted 1104
5 SASI_Hs01_00195417 predicted 1660
6 SASI_Hs01_00195418 predicted 744
7 SASI_Hs01_00195419 predicted 556
8 SASI_Hs02_00303272 predicted 1269
9 SASI_Hs01_00195420 predicted 1647
10 SASI_Hs01_00195421 predicted 855
11 SASI_Hs01_00195416 predicted 1209
12 SASI_Hs01_00195422 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088068 predicted 425
2 SASI_Rn01_00088069 predicted 399
3 SASI_Rn01_00088070 predicted 809
4 SASI_Rn01_00088071 predicted 1272
5 SASI_Rn01_00088072 predicted 410
6 SASI_Rn01_00088073 predicted 780
7 SASI_Rn01_00088074 predicted 865
8 SASI_Rn01_00088075 predicted 1009
9 SASI_Rn01_00088076 predicted 360
10 SASI_Rn01_00088077 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156977 predicted 528
2 SASI_Mm01_00156978 predicted 851
3 SASI_Mm01_00156979 predicted 1641
4 SASI_Mm01_00156980 predicted 385
5 SASI_Mm01_00156981 predicted 1074
6 SASI_Mm01_00156982 predicted 749
7 SASI_Mm01_00156983 predicted 1244
8 SASI_Mm01_00156984 predicted 838
9 SASI_Mm01_00156985 predicted 1398
10 SASI_Mm01_00156986 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000808
GABRA3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000808
GABRA3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000808
GABRA3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008067
GABRA3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008067
GABRA3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008067
GABRA3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)