EMAIL THIS PAGE TO A FRIEND

GABRA4

gamma-aminobutyric acid (GABA) A receptor, alpha 4

387 Gene Product Result for
UniProtKB ID: P48169, Q8IYR7
Gene ID:
Human(2557) Summary: Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
Mouse(14397) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
Rat(140675) gamma-aminobutyric acid (GABA) A receptor, alpha 4
domestic guinea pig(100721252) gamma-aminobutyric acid (GABA) A receptor, alpha 4
naked mole-rat(101718327) gamma-aminobutyric acid (GABA) A receptor, alpha 4
sheep(101121776) gamma-aminobutyric acid (GABA) A receptor, alpha 4
Domestic Rabbit(100339882) gamma-aminobutyric acid (GABA) A receptor, alpha 4
chicken(422770) gamma-aminobutyric acid (GABA) A receptor, alpha 4
dog(482132) gamma-aminobutyric acid (GABA) A receptor, alpha 4
cow(282238) gamma-aminobutyric acid (GABA) A receptor, alpha 4
domestic cat(101098052) gamma-aminobutyric acid (GABA) A receptor, alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB5459 Anti-GABA A Receptor α4 Antibody, CT clone, Chemicon®, from rabbit rat, mouse, human
immunoprecipitation (IP), western blot pricing
G9169 Anti-GABAA Receptor (α4 subunit), C-Terminus antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat
western blot pricing
G0170 Anti-GABAA Receptor (α4 subunit), N-Terminus antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat
immunoprecipitation (IP), western blot pricing
SAB2500441 Anti-GABRA4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, immunohistochemistry, western blot pricing
HPA057756 Anti-GABRA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5202148 Monoclonal Anti-GABA A Receptor antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202157 Monoclonal Anti-GABA A Receptor-Alkaline Phosphatase antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202158 Monoclonal Anti-GABA A Receptor-Allophycocyanin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202149 Monoclonal Anti-GABA A Receptor-Atto 390 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202150 Monoclonal Anti-GABA A Receptor-Atto 488 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202152 Monoclonal Anti-GABA A Receptor-Atto 594 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202151 Monoclonal Anti-GABA A Receptor-Atto 595 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202153 Monoclonal Anti-GABA A Receptor-Atto 633 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202154 Monoclonal Anti-GABA A Receptor-Atto 655 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202155 Monoclonal Anti-GABA A Receptor-Atto 680 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202156 Monoclonal Anti-GABA A Receptor-Atto 700 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202159 Monoclonal Anti-GABA A Receptor-Biotin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202160 Monoclonal Anti-GABA A Receptor-FITC antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202161 Monoclonal Anti-GABA A Receptor-Horseradish Peroxidase antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202162 Monoclonal Anti-GABA A Receptor-PE/Atto 594 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202163 Monoclonal Anti-GABA A Receptor-PerCP antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202164 Monoclonal Anti-GABA A Receptor-R-Phycoerythrin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202165 Monoclonal Anti-GABA A Receptor-Streptavidin antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000809 Rosetta Predictions human pricing
NM_080587 Rosetta Predictions rat pricing
NM_010251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192538 predicted 619
2 SASI_Hs01_00192540 predicted 1414
3 SASI_Hs01_00192541 predicted 289
4 SASI_Hs01_00192542 predicted 1516
5 SASI_Hs01_00192543 predicted 1300
6 SASI_Hs01_00192544 predicted 941
7 SASI_Hs01_00192545 predicted 489
8 SASI_Hs01_00192546 predicted 1032
9 SASI_Hs01_00192547 predicted 565
10 SASI_Hs02_00303273 predicted 1281
11 SASI_Hs01_00192539 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267262 predicted 570
2 SASI_Rn01_00073385 predicted 1225
3 SASI_Rn01_00073386 predicted 1109
4 SASI_Rn01_00073387 predicted 748
5 SASI_Rn01_00073388 predicted 906
6 SASI_Rn01_00073390 predicted 474
7 SASI_Rn01_00073391 predicted 781
8 SASI_Rn01_00073392 predicted 207
9 SASI_Rn01_00073393 predicted 774
10 SASI_Rn01_00073394 predicted 239
11 SASI_Rn01_00073389 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161800 predicted 1067
2 SASI_Mm01_00161801 predicted 983
3 SASI_Mm01_00161803 predicted 1520
4 SASI_Mm02_00318141 predicted 1699
5 SASI_Mm01_00161804 predicted 887
6 SASI_Mm01_00161805 predicted 2074
7 SASI_Mm01_00161806 predicted 646
8 SASI_Mm02_00318142 predicted 1353
9 SASI_Mm01_00161807 predicted 616
10 SASI_Mm01_00161808 predicted 2084
11 SASI_Mm01_00161802 predicted 1200
12 SASI_Mm01_00161809 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000809
GABRA4 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000809
GABRA4 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000809
GABRA4 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010251
GABRA4 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010251
GABRA4 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010251
GABRA4 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???