EMAIL THIS PAGE TO A FRIEND

GABRA4

gamma-aminobutyric acid (GABA) A receptor, alpha 4

265 Gene Product Result for
UniProtKB ID: P48169, Q8IYR7
Gene ID:
Human(2557) Summary: Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
Mouse(14397) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
Rat(140675) gamma-aminobutyric acid (GABA) A receptor, alpha 4
domestic guinea pig(100721252) gamma-aminobutyric acid (GABA) A receptor, alpha 4
naked mole-rat(101718327) gamma-aminobutyric acid (GABA) A receptor, alpha 4
sheep(101121776) gamma-aminobutyric acid (GABA) A receptor, alpha 4
Domestic Rabbit(100339882) gamma-aminobutyric acid (GABA) A receptor, alpha 4
chicken(422770) gamma-aminobutyric acid (GABA) A receptor, alpha 4
dog(482132) gamma-aminobutyric acid (GABA) A receptor, alpha 4
cow(282238) gamma-aminobutyric acid (GABA) A receptor, alpha 4
domestic cat(101098052) gamma-aminobutyric acid (GABA) A receptor, alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G9169 Anti-GABAA Receptor (α4 subunit), C-Terminus antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat
western blot pricing
G0170 Anti-GABAA Receptor (α4 subunit), N-Terminus antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat
immunoprecipitation (IP), western blot pricing
SAB2500441 Anti-GABRA4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, immunohistochemistry, western blot pricing
HPA057756 Anti-GABRA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5202148 Monoclonal Anti-GABA A Receptor antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202157 Monoclonal Anti-GABA A Receptor-Alkaline Phosphatase antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202158 Monoclonal Anti-GABA A Receptor-Allophycocyanin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202149 Monoclonal Anti-GABA A Receptor-Atto 390 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202150 Monoclonal Anti-GABA A Receptor-Atto 488 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202152 Monoclonal Anti-GABA A Receptor-Atto 594 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202151 Monoclonal Anti-GABA A Receptor-Atto 595 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202153 Monoclonal Anti-GABA A Receptor-Atto 633 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202154 Monoclonal Anti-GABA A Receptor-Atto 655 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202155 Monoclonal Anti-GABA A Receptor-Atto 680 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202156 Monoclonal Anti-GABA A Receptor-Atto 700 antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202159 Monoclonal Anti-GABA A Receptor-Biotin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202160 Monoclonal Anti-GABA A Receptor-FITC antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202161 Monoclonal Anti-GABA A Receptor-Horseradish Peroxidase antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202162 Monoclonal Anti-GABA A Receptor-PE/Atto 594 antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202163 Monoclonal Anti-GABA A Receptor-PerCP antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing
SAB5202164 Monoclonal Anti-GABA A Receptor-R-Phycoerythrin antibody produced in mouse clone S398A-34 mouse, human
immunofluorescence, western blot pricing
SAB5202165 Monoclonal Anti-GABA A Receptor-Streptavidin antibody produced in mouse clone S398A-34 human, mouse
immunofluorescence, western blot pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000809 Rosetta Predictions human pricing
NM_080587 Rosetta Predictions rat pricing
NM_010251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192538 predicted 619
2 SASI_Hs01_00192540 predicted 1414
3 SASI_Hs01_00192541 predicted 289
4 SASI_Hs01_00192542 predicted 1516
5 SASI_Hs01_00192543 predicted 1300
6 SASI_Hs01_00192544 predicted 941
7 SASI_Hs01_00192545 predicted 489
8 SASI_Hs01_00192546 predicted 1032
9 SASI_Hs01_00192547 predicted 565
10 SASI_Hs02_00303273 predicted 1281
11 SASI_Hs01_00192539 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267262 predicted 570
2 SASI_Rn01_00073385 predicted 1225
3 SASI_Rn01_00073386 predicted 1109
4 SASI_Rn01_00073387 predicted 748
5 SASI_Rn01_00073388 predicted 906
6 SASI_Rn01_00073390 predicted 474
7 SASI_Rn01_00073391 predicted 781
8 SASI_Rn01_00073392 predicted 207
9 SASI_Rn01_00073393 predicted 774
10 SASI_Rn01_00073394 predicted 239
11 SASI_Rn01_00073389 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161800 predicted 1067
2 SASI_Mm01_00161801 predicted 983
3 SASI_Mm01_00161803 predicted 1520
4 SASI_Mm02_00318141 predicted 1699
5 SASI_Mm01_00161804 predicted 887
6 SASI_Mm01_00161805 predicted 2074
7 SASI_Mm01_00161806 predicted 646
8 SASI_Mm02_00318142 predicted 1353
9 SASI_Mm01_00161807 predicted 616
10 SASI_Mm01_00161808 predicted 2084
11 SASI_Mm01_00161802 predicted 1200
12 SASI_Mm01_00161809 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000809
GABRA4 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000809
GABRA4 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000809
GABRA4 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-698s1c1
Sequence:CCGGCCTTTGAAATTCGGGAGTTATCTCGAGATAACTCCCGAATTTCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-527s1c1
Sequence:CCGGCCTGATACTTTCTTCAGGAATCTCGAGATTCCTGAAGAAAGTATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-709s1c1
Sequence:CCGGCGGGAGTTATGCCTATCCAAACTCGAGTTTGGATAGGCATAACTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-795s1c1
Sequence:CCGGCCAGCTTAGTTCAATATGATTCTCGAGAATCATATTGAACTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000809.2-1741s1c1
Sequence:CCGGCATGGTTTATTGGGTTGTTTACTCGAGTAAACAACCCAATAAACCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000809.2-895s21c1
Sequence:CCGGCAGACGGAAGATGGGTTATTTCTCGAGAAATAACCCATCTTCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010251
GABRA4 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010251
GABRA4 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010251
GABRA4 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010251.1-2321s1c1
Sequence:CCGGGCTAGAAAGTGAACCATCTTTCTCGAGAAAGATGGTTCACTTTCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-2073s1c1
Sequence:CCGGCCAGTCACATTTGGAGCATTTCTCGAGAAATGCTCCAAATGTGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1359s1c1
Sequence:CCGGGCTAGAACTGTATTTGGAATACTCGAGTATTCCAAATACAGTTCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-1644s1c1
Sequence:CCGGGCCAATTTGAACATGAGGAAACTCGAGTTTCCTCATGTTCAAATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010251.1-606s1c1
Sequence:CCGGCAGAACTCAAAGGACGAGAAACTCGAGTTTCTCGTCCTTTGAGTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010251.2-1518s21c1
Sequence:CCGGTCAACTATTTCACCAACATTCCTCGAGGAATGTTGGTGAAATAGTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010251.2-2288s21c1
Sequence:CCGGAGATATGGAGAGAGTTAATTACTCGAGTAATTAACTCTCTCCATATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)