EMAIL THIS PAGE TO A FRIEND

GABRA5

gamma-aminobutyric acid (GABA) A receptor, alpha 5

225 Gene Product Result for
Gene ID:
Human(2558) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]
Mouse(110886) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
Rat(29707) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Zebrafish(799124) gamma-aminobutyric acid (GABA) A receptor, alpha 5
dog(488688) gamma-aminobutyric acid (GABA) A receptor, alpha 5
cow(523515) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Horse(100050880) gamma-aminobutyric acid (GABA) A receptor, alpha 5
domestic cat(101090773) gamma-aminobutyric acid (GABA) A receptor, alpha 5
chicken(418684) gamma-aminobutyric acid (GABA) A receptor, alpha 5
sheep(101115159) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Domestic Rabbit(100340943) gamma-aminobutyric acid (GABA) A receptor, alpha 5
naked mole-rat(101712275) gamma-aminobutyric acid (GABA) A receptor, alpha 5
domestic guinea pig(100729411) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB9678 Anti-GABA A Receptor α 5 Antibody Chemicon®, from rabbit mouse, rat
western blot pricing
G9294 Anti-GABAA Receptor (α5 subunit), Cytosolic Loop antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat
immunoprecipitation (IP), western blot pricing
SAB2108666 Anti-GABRA5 affinity isolated antibody rabbit, human, horse
western blot pricing
SAB2100878 Anti-GABRA5 (ab2) antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, human, rat
immunohistochemistry, western blot pricing
HPA077031 Anti-GABRA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2700871 Anti-GABRA5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2701358 Anti-GABRA5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB5202238 Monoclonal Anti-GABA A Receptor antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202247 Monoclonal Anti-GABA A Receptor-Alkaline Phosphatase antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202248 Monoclonal Anti-GABA A Receptor-Allophycocyanin antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202239 Monoclonal Anti-GABA A Receptor-Atto 390 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202240 Monoclonal Anti-GABA A Receptor-Atto 488 antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202242 Monoclonal Anti-GABA A Receptor-Atto 594 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202241 Monoclonal Anti-GABA A Receptor-Atto 595 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202243 Monoclonal Anti-GABA A Receptor-Atto 633 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202244 Monoclonal Anti-GABA A Receptor-Atto 655 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202245 Monoclonal Anti-GABA A Receptor-Atto 680 antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202246 Monoclonal Anti-GABA A Receptor-Atto 700 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202249 Monoclonal Anti-GABA A Receptor-Biotin antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202250 Monoclonal Anti-GABA A Receptor-FITC antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202251 Monoclonal Anti-GABA A Receptor-Horseradish Peroxidase antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202252 Monoclonal Anti-GABA A Receptor-PE/Atto 594 antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing
SAB5202253 Monoclonal Anti-GABA A Receptor-PerCP antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202254 Monoclonal Anti-GABA A Receptor-R-Phycoerythrin antibody produced in mouse clone S415-24 human, mouse
immunofluorescence, western blot pricing
SAB5202255 Monoclonal Anti-GABA A Receptor-Streptavidin antibody produced in mouse clone S415-24 mouse, human
immunofluorescence, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
L9787 L-655,708 ≥98% (HPLC), powder human pricing
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077241 MISSION® esiRNA targeting human GABRA5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000810 Rosetta Predictions human pricing
NM_017295 Rosetta Predictions rat pricing
NM_176942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129486 predicted 1435
2 SASI_Hs01_00129487 predicted 1585
3 SASI_Hs01_00129488 predicted 644
4 SASI_Hs01_00129489 predicted 1145
5 SASI_Hs01_00129490 predicted 1563
6 SASI_Hs01_00129491 predicted 919
7 SASI_Hs01_00129492 predicted 910
8 SASI_Hs01_00129493 predicted 1155
9 SASI_Hs01_00129494 predicted 923
10 SASI_Hs01_00129495 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037030 predicted 298
2 SASI_Rn01_00037031 predicted 864
3 SASI_Rn01_00037032 predicted 558
4 SASI_Rn01_00037033 predicted 701
5 SASI_Rn01_00037034 predicted 1520
6 SASI_Rn02_00261733 predicted 1767
7 SASI_Rn01_00037035 predicted 417
8 SASI_Rn01_00037036 predicted 356
9 SASI_Rn01_00037037 predicted 1621
10 SASI_Rn01_00037038 predicted 730
11 SASI_Rn01_00037039 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096262 predicted 1440
2 SASI_Mm01_00096263 predicted 401
3 SASI_Mm01_00096264 predicted 1658
4 SASI_Mm01_00096265 predicted 361
5 SASI_Mm02_00346837 predicted 357
6 SASI_Mm01_00096266 predicted 464
7 SASI_Mm01_00096267 predicted 439
8 SASI_Mm02_00346838 predicted 444
9 SASI_Mm01_00096270 predicted 1669
10 SASI_Mm01_00096271 predicted 1265
11 SASI_Mm01_00096268 predicted 1365
12 SASI_Mm01_00096269 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000810
VALIDATED
GABRA5 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000810
VALIDATED
GABRA5 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000810
VALIDATED
GABRA5 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176942
GABRA5 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176942
GABRA5 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176942
GABRA5 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)