EMAIL THIS PAGE TO A FRIEND

GABRA6

gamma-aminobutyric acid (GABA) A receptor, alpha 6

187 Gene Product Result for
UniProtKB ID: Q16445, A8K096, Q4VAV2
Gene ID:
Human(2559) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
Mouse(14399) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
Rat(29708) gamma-aminobutyric acid (GABA) A receptor, alpha 6
domestic guinea pig(100720891) gamma-aminobutyric acid (GABA) A receptor, alpha 6
naked mole-rat(101720123) gamma-aminobutyric acid (GABA) A receptor, alpha 6
sheep(101117503) gamma-aminobutyric acid (GABA) A receptor, alpha 6
chicken(395931) gamma-aminobutyric acid (GABA) A receptor, alpha 6
cow(539194) gamma-aminobutyric acid (GABA) A receptor, alpha 6
Horse(100070890) gamma-aminobutyric acid (GABA) A receptor, alpha 6
domestic cat(101093992) gamma-aminobutyric acid (GABA) A receptor, alpha 6
dog(489145) gamma-aminobutyric acid (GABA) A receptor, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000811 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000761 MISSION® esiRNA targeting human GABRA6 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000811 Rosetta Predictions human pricing
NM_021841 Rosetta Predictions rat pricing
NM_001099641 Rosetta Predictions mouse pricing
NM_008068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178765 predicted 939
2 SASI_Hs01_00178766 predicted 1628
3 SASI_Hs01_00178767 predicted 808
4 SASI_Hs01_00178768 predicted 977
5 SASI_Hs02_00303274 predicted 363
6 SASI_Hs02_00303275 predicted 1670
7 SASI_Hs01_00178769 predicted 1762
8 SASI_Hs01_00178770 predicted 1299
9 SASI_Hs01_00178771 predicted 883
10 SASI_Hs01_00178774 predicted 1073
11 SASI_Hs01_00178772 predicted 944
12 SASI_Hs01_00178773 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043524 predicted 714
2 SASI_Rn01_00043526 predicted 508
3 SASI_Rn01_00043527 predicted 808
4 SASI_Rn01_00043528 predicted 478
5 SASI_Rn01_00043529 predicted 1088
6 SASI_Rn01_00043530 predicted 718
7 SASI_Rn01_00043531 predicted 663
8 SASI_Rn02_00262854 predicted 909
9 SASI_Rn01_00043532 predicted 567
10 SASI_Rn01_00043533 predicted 423
11 SASI_Rn01_00043525 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301925 predicted 1593
2 SASI_Mm02_00301926 predicted 1563
3 SASI_Mm02_00301927 predicted 791
4 SASI_Mm02_00301928 predicted 1629
5 SASI_Mm02_00301929 predicted 827
6 SASI_Mm02_00301930 predicted 941
7 SASI_Mm02_00301931 predicted 967
8 SASI_Mm02_00301932 predicted 1195
9 SASI_Mm02_00301933 predicted 1581
10 SASI_Mm02_00301934 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313053 predicted 1558
2 SASI_Mm01_00190535 predicted 1538
3 SASI_Mm01_00190537 predicted 762
4 SASI_Mm01_00190539 predicted 1593
5 SASI_Mm01_00190540 predicted 796
6 SASI_Mm01_00190541 predicted 913
7 SASI_Mm01_00190542 predicted 939
8 SASI_Mm02_00313054 predicted 1163
9 SASI_Mm02_00313055 predicted 1545
10 SASI_Mm02_00313056 predicted 968
11 SASI_Mm01_00190534 predicted 1265
12 SASI_Mm01_00190536 predicted 624
13 SASI_Mm01_00190538 predicted 601
14 SASI_Mm01_00190543 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008068
GABRA6 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008068
GABRA6 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008068
GABRA6 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000811
GABRA6 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000811
GABRA6 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000811
GABRA6 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)