EMAIL THIS PAGE TO A FRIEND

GABRB1

gamma-aminobutyric acid (GABA) A receptor, beta 1

185 Gene Product Result for
UniProtKB ID: P18505, B2R6U7, Q16166, Q8TBK3
Gene ID:
Human(2560) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
Mouse(14400) gamma-aminobutyric acid (GABA) A receptor, subunit beta 1
Rat(25450) gamma-aminobutyric acid (GABA) A receptor, beta 1
Zebrafish(100331377) gamma-aminobutyric acid (GABA) A receptor, beta 1
cow(282239) gamma-aminobutyric acid (GABA) A receptor, beta 1
domestic cat(101097640) gamma-aminobutyric acid (GABA) A receptor, beta 1
dog(100687745) gamma-aminobutyric acid (GABA) A receptor, beta 1
sheep(101122358) gamma-aminobutyric acid (GABA) A receptor, beta 1
naked mole-rat(101717539) gamma-aminobutyric acid (GABA) A receptor, beta 1
domestic guinea pig(100719515) gamma-aminobutyric acid (GABA) A receptor, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z0502 Zaleplon ≥98% (HPLC), solid human pricing
1724350 Zaleplon United States Pharmacopeia (USP) Reference Standard human pricing
Z-004 Zaleplon solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0002139 Zolpidem for system suitability CRS, European Pharmacopoeia (EP) Reference Standard human pricing
Z-017 Zolpidem solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing
Z103 Zolpidem ≥98% (HPLC), solid human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000812 Rosetta Predictions human pricing
NM_012956 Rosetta Predictions rat pricing
NM_008069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303276 predicted 804
2 SASI_Hs01_00096954 predicted 282
3 SASI_Hs01_00096955 predicted 1046
4 SASI_Hs01_00096956 predicted 392
5 SASI_Hs02_00303277 predicted 770
6 SASI_Hs01_00096957 predicted 755
7 SASI_Hs01_00096958 predicted 635
8 SASI_Hs01_00096960 predicted 983
9 SASI_Hs01_00096962 predicted 1431
10 SASI_Hs01_00096963 predicted 921
11 SASI_Hs01_00096959 predicted 1056
12 SASI_Hs01_00096961 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260544 predicted 1474
2 SASI_Rn01_00087141 predicted 365
3 SASI_Rn01_00087142 predicted 964
4 SASI_Rn01_00087144 predicted 354
5 SASI_Rn01_00087145 predicted 984
6 SASI_Rn01_00087146 predicted 1388
7 SASI_Rn01_00087147 predicted 1391
8 SASI_Rn01_00087148 predicted 622
9 SASI_Rn01_00087149 predicted 289
10 SASI_Rn01_00087150 predicted 817
11 SASI_Rn01_00087143 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313057 predicted 302
2 SASI_Mm01_00050635 predicted 1072
3 SASI_Mm01_00050636 predicted 273
4 SASI_Mm02_00313058 predicted 532
5 SASI_Mm01_00050639 predicted 473
6 SASI_Mm01_00050640 predicted 909
7 SASI_Mm01_00050641 predicted 888
8 SASI_Mm01_00050642 predicted 208
9 SASI_Mm01_00050643 predicted 226
10 SASI_Mm01_00050644 predicted 1107
11 SASI_Mm01_00050637 predicted 1409
12 SASI_Mm01_00050638 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008069
GABRB1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008069
GABRB1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008069
GABRB1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000812
GABRB1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000812
GABRB1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000812
GABRB1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)