EMAIL THIS PAGE TO A FRIEND

GABRB2

gamma-aminobutyric acid (GABA) A receptor, beta 2

398 Gene Product Result for
Gene ID:
Human(2561) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
Mouse(14401) gamma-aminobutyric acid (GABA) A receptor, subunit beta 2
Rat(25451) gamma-aminobutyric acid (GABA) A receptor, beta 2
domestic guinea pig(100720162) gamma-aminobutyric acid (GABA) A receptor, beta 2
naked mole-rat(101721168) gamma-aminobutyric acid (GABA) A receptor, beta 2
sheep(100913155) gamma-aminobutyric acid (GABA) A receptor, beta 2
Domestic Rabbit(100356357) gamma-aminobutyric acid (GABA) A receptor, beta 2
Zebrafish(336252) gamma-aminobutyric acid (GABA) A receptor, beta 2
domestic cat(101094237) gamma-aminobutyric acid (GABA) A receptor, beta 2
cow(540657) gamma-aminobutyric acid (GABA) A receptor, beta 2
Horse(100059608) gamma-aminobutyric acid (GABA) A receptor, beta 2
dog(489146) gamma-aminobutyric acid (GABA) A receptor, beta 2
chicken(414890) gamma-aminobutyric acid (GABA) A receptor, beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0282 AQUA Peptide FSTGSYP[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000813 Rosetta Predictions human pricing
NM_021911 Rosetta Predictions human pricing
NM_012957 Rosetta Predictions rat pricing
NM_008070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303278 predicted 1577
2 SASI_Hs02_00303279 predicted 425
3 SASI_Hs02_00303280 predicted 291
4 SASI_Hs02_00303281 predicted 305
5 SASI_Hs01_00091809 predicted 503
6 SASI_Hs02_00303282 predicted 972
7 SASI_Hs02_00303283 predicted 736
8 SASI_Hs01_00091810 predicted 512
9 SASI_Hs02_00303284 predicted 338
10 SASI_Hs02_00303285 predicted 841
11 SASI_Hs01_00091807 predicted 498
12 SASI_Hs01_00091808 predicted 836
13 SASI_Hs01_00091811 predicted 1064
14 SASI_Hs01_00091812 predicted 909
15 SASI_Hs01_00091813 predicted 755
16 SASI_Hs01_00091814 predicted 770
17 SASI_Hs01_00091815 predicted 795
18 SASI_Hs01_00091816 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355183 predicted 1689
2 SASI_Hs02_00355184 predicted 421
3 SASI_Hs02_00355185 predicted 289
4 SASI_Hs02_00355186 predicted 302
5 SASI_Hs01_00237611 predicted 496
6 SASI_Hs02_00355187 predicted 969
7 SASI_Hs02_00355188 predicted 736
8 SASI_Hs01_00237612 predicted 514
9 SASI_Hs02_00355189 predicted 331
10 SASI_Hs02_00355190 predicted 838
11 SASI_Hs01_00237609 predicted 498
12 SASI_Hs01_00237610 predicted 844
13 SASI_Hs01_00237613 predicted 1069
14 SASI_Hs01_00237614 predicted 905
15 SASI_Hs01_00237615 predicted 756
16 SASI_Hs01_00237616 predicted 768
17 SASI_Hs01_00237617 predicted 798
18 SASI_Hs01_00237618 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260545 predicted 752
2 SASI_Rn01_00032234 predicted 599
3 SASI_Rn02_00260546 predicted 541
4 SASI_Rn02_00260547 predicted 1033
5 SASI_Rn02_00260548 predicted 683
6 SASI_Rn01_00032241 predicted 296
7 SASI_Rn01_00032242 predicted 234
8 SASI_Rn01_00032243 predicted 909
9 SASI_Rn02_00260549 predicted 272
10 SASI_Rn02_00260550 predicted 435
11 SASI_Rn01_00032235 predicted 1165
12 SASI_Rn01_00032236 predicted 1529
13 SASI_Rn01_00032237 predicted 615
14 SASI_Rn01_00032238 predicted 1255
15 SASI_Rn01_00032239 predicted 895
16 SASI_Rn01_00032240 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195315 predicted 1044
2 SASI_Mm01_00195316 predicted 511
3 SASI_Mm01_00195317 predicted 1179
4 SASI_Mm01_00195318 predicted 656
5 SASI_Mm01_00195319 predicted 942
6 SASI_Mm01_00195320 predicted 505
7 SASI_Mm01_00195321 predicted 601
8 SASI_Mm01_00195322 predicted 1816
9 SASI_Mm01_00195323 predicted 716
10 SASI_Mm01_00195324 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008070
GABRB2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008070
GABRB2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008070
GABRB2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000813
GABRB2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000813
GABRB2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000813
GABRB2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)