EMAIL THIS PAGE TO A FRIEND

GABRB3

gamma-aminobutyric acid (GABA) A receptor, beta 3

404 Gene Product Result for
Synonyms: ECA5
Gene ID:
Human(2562) Summary: This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
Mouse(14402) gamma-aminobutyric acid (GABA) A receptor, subunit beta 3
Rat(24922) gamma-aminobutyric acid (GABA) A receptor, beta 3
Zebrafish(566922) gamma-aminobutyric acid (GABA) A receptor, beta 3
cow(529593) gamma-aminobutyric acid (GABA) A receptor, beta 3
Horse(100050803) gamma-aminobutyric acid (GABA) A receptor, beta 3
domestic cat(100286790) gamma-aminobutyric acid (GABA) A receptor, beta 3
chicken(396290) gamma-aminobutyric acid (GABA) A receptor, beta 3
dog(606913) gamma-aminobutyric acid (GABA) A receptor, beta 3
sheep(101114905) gamma-aminobutyric acid (GABA) A receptor, beta 3
naked mole-rat(101711687) gamma-aminobutyric acid (GABA) A receptor, beta 3
domestic guinea pig(100731340) gamma-aminobutyric acid (GABA) A receptor, beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501404 Anti-GABRB3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat
ELISA, immunohistochemistry pricing
SAB2100880 Anti-GABRB3 antibody produced in rabbit affinity isolated antibody rat, mouse, human, guinea pig, rabbit, bovine, horse, dog
immunohistochemistry, western blot pricing
SAB5200049 Monoclonal Anti-GABRB3 antibody produced in mouse clone S87-25, 1 mg/mL, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
D5297 Dehydroisoandrosterone 3-sulfate sodium salt dihydrate ≥93% (TLC), powder human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1896 Etazolate hydrochloride solid human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
P2016 3α,21-Dihydroxy-5α-pregnan-20-one ≥95% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000814 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060051 MISSION® esiRNA targeting human GABRB3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000814 Rosetta Predictions human pricing
NM_021912 Rosetta Predictions human pricing
NM_017065 Rosetta Predictions rat pricing
NM_001038701 Rosetta Predictions mouse pricing
NM_008071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236856 predicted 746
2 SASI_Hs01_00236857 predicted 896
3 SASI_Hs01_00236858 predicted 445
4 SASI_Hs01_00236860 predicted 1189
5 SASI_Hs02_00303286 predicted 1313
6 SASI_Hs01_00236861 predicted 1321
7 SASI_Hs01_00236862 predicted 1186
8 SASI_Hs01_00236863 predicted 1063
9 SASI_Hs01_00236864 predicted 867
10 SASI_Hs01_00236865 predicted 426
11 SASI_Hs01_00236859 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179300 predicted 667
2 SASI_Hs01_00179301 predicted 808
3 SASI_Hs01_00179302 predicted 356
4 SASI_Hs01_00179304 predicted 1103
5 SASI_Hs02_00355191 predicted 1225
6 SASI_Hs01_00179305 predicted 1230
7 SASI_Hs01_00179306 predicted 1101
8 SASI_Hs01_00179307 predicted 976
9 SASI_Hs01_00179308 predicted 772
10 SASI_Hs01_00179309 predicted 344
11 SASI_Hs01_00179303 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086475 predicted 1000
2 SASI_Rn01_00086476 predicted 332
3 SASI_Rn01_00086477 predicted 307
4 SASI_Rn01_00086478 predicted 302
5 SASI_Rn01_00086479 predicted 310
6 SASI_Rn01_00086480 predicted 558
7 SASI_Rn01_00086481 predicted 1240
8 SASI_Rn01_00086482 predicted 1245
9 SASI_Rn01_00086483 predicted 1111
10 SASI_Rn01_00086484 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197293 predicted 1080
2 SASI_Mm02_00289692 predicted 1084
3 SASI_Mm01_00197294 predicted 342
4 SASI_Mm01_00197296 predicted 527
5 SASI_Mm01_00197297 predicted 660
6 SASI_Mm01_00197298 predicted 1199
7 SASI_Mm01_00197300 predicted 1135
8 SASI_Mm01_00197301 predicted 787
9 SASI_Mm01_00197302 predicted 781
10 SASI_Mm02_00289693 predicted 320
11 SASI_Mm01_00197295 predicted 1144
12 SASI_Mm01_00197299 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117089 predicted 1148
2 SASI_Mm02_00313059 predicted 1154
3 SASI_Mm01_00117090 predicted 407
4 SASI_Mm01_00117092 predicted 588
5 SASI_Mm01_00117093 predicted 727
6 SASI_Mm01_00117094 predicted 1276
7 SASI_Mm01_00117096 predicted 1196
8 SASI_Mm01_00117097 predicted 854
9 SASI_Mm01_00117098 predicted 847
10 SASI_Mm02_00313060 predicted 387
11 SASI_Mm01_00117091 predicted 1215
12 SASI_Mm01_00117095 predicted 1286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008071
VALIDATED
GABRB3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-319s21c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1420s21c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-962s21c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1211s21c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008071.3-2370s21c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-1181s1c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-2340s1c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-289s1c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-1390s1c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-932s1c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008071
VALIDATED
GABRB3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-319s21c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1420s21c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-962s21c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1211s21c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008071.3-2370s21c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-1181s1c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-2340s1c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-289s1c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-1390s1c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-932s1c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008071
VALIDATED
GABRB3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 3
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000326447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-319s21c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1420s21c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-962s21c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008071.3-1211s21c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008071.3-2370s21c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-1181s1c1
Sequence:CCGGGCACCGATGGATGTTCACAATCTCGAGATTGTGAACATCCATCGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-2340s1c1
Sequence:CCGGCCAGATTTCTAGGTCTGCTATCTCGAGATAGCAGACCTAGAAATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-289s1c1
Sequence:CCGGCGACATGGTTTCTGAAGTCAACTCGAGTTGACTTCAGAAACCATGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008071.2-1390s1c1
Sequence:CCGGCCCTGATCTAACCGATGTGAACTCGAGTTCACATCGGTTAGATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008071.2-932s1c1
Sequence:CCGGACAACCATCAACACTCACCTTCTCGAGAAGGTGAGTGTTGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000814
VALIDATED
GABRB3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1531s21c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-899s21c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1198s21c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-494s1c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-497s21c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1251s1c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-896s1c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1528s1c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1195s1c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1254s21c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000814
VALIDATED
GABRB3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1531s21c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-899s21c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000310447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1198s21c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-494s1c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-497s21c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1251s1c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-896s1c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1528s1c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1195s1c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1254s21c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000814
VALIDATED
GABRB3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 3
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000299638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1531s21c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-899s21c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1198s21c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-494s1c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-497s21c1
Sequence:CCGGCCCGACACATATTTCTTAAATCTCGAGATTTAAGAAATATGTGTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1251s1c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-896s1c1
Sequence:CCGGCCCTCTATACTGATAACGATTCTCGAGAATCGTTATCAGTATAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1528s1c1
Sequence:CCGGCAACTTAGTTTACTGGCTGTACTCGAGTACAGCCAGTAAACTAAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000814.3-1195s1c1
Sequence:CCGGCCGTTCAAAGAGCGAAAGCAACTCGAGTTGCTTTCGCTCTTTGAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000814.4-1254s21c1
Sequence:CCGGCGCTGGAAGTTCACAATGAAACTCGAGTTTCATTGTGAACTTCCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)